Genomics
2 Transcripts
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:T21E12.4a.1 | T21E12.4a.1 |
13864
 |
I: 4386785-4401907 |
| Transcript:T21E12.4b.1 | T21E12.4b.1 |
10911
|
I: 4390095-4401755 |
Other
2 CDSs
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| CDS:T21E12.4a | T21E12.4a |
13707
|
I: 4386790-4387461 |
| CDS:T21E12.4b | T21E12.4b |
10911
|
I: 4390095-4391499 |
43 RNAi Result
202 Allele
| Public Name |
|---|
| gk962706 |
| gk963902 |
| gk964159 |
| gk964070 |
| WBVar01431375 |
| WBVar01431374 |
| WBVar01431373 |
| WBVar01431372 |
| WBVar01602953 |
| gk568153 |
| gk677826 |
| gk442865 |
| gk918913 |
| gk912641 |
| gk848653 |
| gk856676 |
| gk630405 |
| gk785073 |
| gk830669 |
| gk639585 |
| gk418449 |
| gk509357 |
| gk660692 |
| gk856678 |
| gk856677 |
| gk830668 |
| gk581030 |
| gk497430 |
| gk872301 |
| gk868352 |
1 Chromosome Location
|
Feature . Primary Identifier |
Start | End | Strand |
|---|---|---|---|
| WBGene00000962 | 4386785 | 4401907 | 1 |
4 Data Sets
| Name | URL |
|---|---|
| WormBaseAcedbConverter | |
| GO Annotation data set | |
| C. elegans genomic annotations (GFF3 Gene) | |
| Panther orthologue and paralogue predictions |
1 Downstream Intergenic Region
| WormBase ID | Name | Sequence Name | Length (nt) | Chromosome Location | Organism |
|---|---|---|---|---|---|
| intergenic_region_chrI_4401908..4401955 | 48 | I: 4401908-4401955 | Caenorhabditis elegans |
161 Expression Clusters
| Regulated By Treatment | Description | Algorithm | Primary Identifier |
|---|---|---|---|
| oocyte proteins identified by two or more unique peptides during proteomics study. | In the pooled data set, 1453 C. elegans proteins were identified with a probability >= 0.9 according to ProteinProphet, of which 1165 proteins were identified by more than one unique peptide. | WBPaper00038289:oocyte_protein | |
| Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons. | DESeq. False discovry rate (FDR) < 0.1. | WBPaper00048988:neuron_expressed | |
| Transcripts of coding genes that showed significantly decreased expression in muscle. | DESeq2 (version 1.24.0). Transcripts with a false-discovery rate adjusted p-value less than 0.05 were considered significantly differentially expressed. | WBPaper00062325:muscle_depleted_coding-RNA | |
| Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference). | A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. | WBPaper00037950:all-neurons_L1-larva_expressed | |
| adult vs dauer larva | Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C. | N.A. | WBPaper00050488:adult_vs_dauer_regulated_N2_20C |
| Osmotic stress | Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when no food was present | DESeq(version 1.10.1), FDR < 0.05. | WBPaper00050726:OsmoticStress_regulated_NoFood |
| Transcripts that showed significantly increased expression after animals were treated with 50uM Rifampicin from day 1 to day 3 adult hermaphradite. | DESeq2(v1.14.1), fold change > 2, p-value < 0.05 | WBPaper00055354:Rifampicin_upregulated | |
| Transcripts that showed significantly increased expression in pri-1(RNAi) animals comparing to in N2 animals fed with empty vector. | Differential expression analysis was performed quasi-likelihood F-test with the generalized linear model (GLM) approach in edgeR ver 3.32.1. FDR < 0.05, fold change > 2. | WBPaper00066418:pri-1(RNAi)_upregulated | |
| Transcripts expressed in the epithelial tissues surrounding the pharynx that includes the arcade and intestinal valve (AIV) cells, according to PAT-Seq analysis using Pbath-15-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:arcade_intestinal-valve_expressed | |
| Transcripts expressed in body muscle, according to PAT-Seq analysis using Pmyo-3-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:body-muscle_expressed | |
| Transcripts expressed in GABAergic neuron, according to PAT-Seq analysis using Punc-47-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:GABAergic-neuron_expressed | |
| Proteins interacting with NHR-49-GFP according to co-IP and LC-MS. | N.A. | WBPaper00064071:NHR-49_interacting | |
| Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:hypodermis_expressed | |
| Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:intestine_expressed | |
| Transcripts expressed in NMDA neuron, according to PAT-Seq analysis using Pnmr-1-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:NMDA-neuron_expressed | |
| Transcripts expressed in seam cells, according to PAT-Seq analysis using Pgrd-10-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:seam_expressed | |
| Transcripts detected in germline isolated from day-1 adult hermaphrodite animals. | All three experiments have CPM >= 1. | WBPaper00067147:germline_expressed | |
| Proteins interacting with GST-FBXA-210(C-terminal) via IP-MS in young adult animals. Proteins shown here are enriched in GST | Fold change > 2 and p-value < 0.1 were defined as threshold for significance. | WBPaper00068277:FBXA-210(C-terminal)_interacting_YoungAdult | |
| Transcripts that showed significantly altered expression after 24 hour exposure to stavudine (d4T) starting at L1 lava stage. | DESeq | WBPaper00053302:stavudine_24h_regulated | |
| Transcripts depleted in purified oocyte P bodies comparing to in whole oocytes. | DESeq2, FDR < 0.05, fold change > 2. | WBPaper00065975:P-body_vs_oocyte_depleted | |
| Transcripts detected in body muscle nuclei according to a nuclear FACS-based strategy. | Cufflinks | WBPaper00065120:body-muscle-transcriptome | |
| Temprature shift to 28C for 24 hours. | Transcripts that showed significantly decreased expression after animals were exposed to 28C temperature for 24 hours. | Differentially expressed genes wereidentified using DESeq (v.1.18.0) by normalizing readsbased on the negative binomial distribution method andcomparing each HS timepoint to the 0-h control. | WBPaper00061341:28C_24h_downregulated |
| Proteins that showed significantly decreased expression after 1-day-old wild type adults were exposed to cisplatin (300ug per mL) for 6 hours. | The differential expression analysis was performed in R. Differentially expressed proteins were identified by using a two-sided t-test on log-transformed data. | WBPaper00065373:Cisplatin_downregulated_WT | |
| Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference). | A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. | WBPaper00037950:GABAergic-motor-neurons_L2-larva_expressed | |
| Genes that showed expression levels higher than the corresponding reference sample (embryonic 0hr reference). | A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. | WBPaper00037950:germline-precursors_blastula-embryo_expressed | |
| Bacteria infection: Staphylococcus aureus | mRNAs that showed increased expression 8 hours after N2 animals were infected by S. aureus. | DESeq, p <= 0.05 | WBPaper00045314:S.aureus-induced_N2 |
| Genes that showed expression levels higher than the corresponding reference sample (L3/L4 all cell reference). | A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. | WBPaper00037950:PVD-OLL-neurons_L3-L4-larva_expressed | |
| Transcripts that showed significantly increased expression in ilc-17.1(syb5296) comparing to in N2 animals at L4 larva stage. | DESeq2, fold change > 2, FDR < 0.05. | WBPaper00066594:ilc-17.1(syb5296)_upregulated | |
| Transcripts that showed significantly increased expression in pry-1(mu38) animals comparing to in N2 at L1 larva stage. | DESeq, FDR < 0.05 | WBPaper00055626:pry-1(mu38)_upregulated | |
| Proteins identified in extracellular vesicle. | N.A. | WBPaper00062669:extracellular-vesicle_protein |
20 Expression Patterns
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| Strain: BC13242 | [dhc-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTGAGCAAACGCATCATACAG] 3' and primer B 5' [ATTCCCACTATCGATTACCTGAAA] 3'. | Expr6732 | Adult Expression: pharynx; pharyngeal gland cells; anal depressor muscle; body wall muscle; hypodermis; Nervous System; head neurons; unidentified cells in head; unidentified cells in tail ; Larval Expression: pharynx; intestine; body wall muscle; hypodermis; Nervous System; head neurons; unidentified cells in head; unidentified cells in tail ; | |
| Expr1030597 | Tiling arrays expression graphs | |||
| Picture: Figure 3C. | Expr8622 | Endogenous DHC-1 was localized uniformly on metaphase meiotic spindles and concentrated at poles of rotated meiotic spindles. | ||
| Picture: Figure 3A, 3B. | Expr8621 | During eight of eight time-lapse sequences of wild-type meiosis, GFP:DHC-1 was uniformly localized throughout the meiotic spindle before APC activation. Within 45 to 30 s before spindle rotation, GFP:DHC-1 began to accumulate at both spindle poles and continued to accumulate at the meiotic spindle poles through rotation. After rotation, GFP:DHC-1 stayed on the meiotic spindle poles but did not accumulate further. In some cases, DHC-1 accumulated slightly more on one pole versus the other (Figure 3B), but there was no consistent trend of which pole was brighter between the proximal pole (near the cortex) and distal pole. | ||
| Expr13421 | DHC-1 was observed, as previously reported, in perinuclear patches in the transition zone (Sato et al., 2009) and at the nuclear envelope in pachytene. | |||
| Expr2010871 | Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans). | |||
| Expr13458 | Epifluorescence microscopy revealed that mCherry::DHC-1 and eGFP::DHC-1 are expressed in all somatic tissues and in the germline. After imaging early embryos by spinning-disk confocal fluorescence microscopy (SDCM), DHC-1 was detected in the cytoplasm during all stages of the cell cycle and localized specifically to the nuclear envelope, centrosomes, kinetochores, kinetochore MTs, central spindle, astral MTs, and the cell cortex during mitosis. This localization pattern is in accordance with previous immunohistochemistry and overexpression studies (Schmidt et al., 2005; Nguyen-Ngoc et al., 2007; Gassmann et al., 2008; Kimura and Kimura, 2011). In addition, we noticed comet like accumulations of dynein radiating from the centrosomes to the cell periphery in a pattern that appeared to follow the mitotic astral MT network.Endogenous dynein complex tracks MT plus ends. This was observed in one cell embryos and in later stages of C. elegans embryos (4-cell embryos). | |||
| Expr3195 | Affinity-purified antibodies revealed a distribution of DHC-1 in wild-type embryos similar to that described previously (See Expr1196): punctate in cytoplasm, an elevated concentration on nuclear envelopes during pronuclear migration, enrichment in the central spindle during metaphase, and faint enrichment over the entire anaphase spindle. A transient accumulation of DHC-1 was also noted in a narrow cortical zone between the AB and P1 cells during rotation of the P1 centrosome-centrosome axis onto the anterior-posterior (AP) axis. | |||
| Expr2029110 | Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans). | |||
| A subcellular distribution analogous to the one reported here was observed in C. elegans embryos using polyclonal antibodies raised against purified dynein heavy chain protein. | Expr1196 | Cytoplasmic dynein was present in a punctate manner throughout the cytoplasm at all stages of the cell cycle. A stronger signal was detected at the periphery of pronuclei in one cell stage embryos and of nuclei in later stage embryos. Cytoplasmic dynein was present at the cell cortex; especially apparent at boundaries between cells, for instance, between the AB and P1 blastomeres of the two cell stage embryo. The distribution of cytoplasmic dynein changed as cells progressed through mitosis. During prometaphase, cytoplasmic dynein accumulated along both sides of prometaphase chromosomes. During early anaphase, strong spindle signal was still detected, both between segregating chromosomes and spindle poles, as well as centrally, between the two sets of chromosomes. A similar staining pattern persisted throughout anaphase. At telophase, cytoplasmic dynein was enriched in two areas of the cytoplasm adjacent to the spindle poles. A strong signal was detected at the periphery of reforming nuclei. | ||
| Expr14489 | DHC-1 was restricted within the dendrite and did not enter cilia. | |||
| Expr1023000 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 | |||
| Expr13457 | DHC-1::GFP was readily detectable on growing MT plus ends in early embryos. dhc-1::gfp knock-in allele. | |||
| Expr15668 | In control embryos, GFP::DHC-1 was enriched at the nuclear envelope, the mitotic spindle, kinetochores and the cell cortex, and a similar localization pattern was observed in control spermatocytes of young adult males. | |||
| Expr15669 | In control embryos, GFP::DHC-1 was enriched at the nuclear envelope, the mitotic spindle, kinetochores and the cell cortex, and a similar localization pattern was observed in control spermatocytes of young adult males. | |||
| Expr13460 | Time-lapse SDCM of eGFP::DHC-1 zygotes revealed no measurable enrichment of dynein at the cortex over cytoplasmic values during metaphase spindle displacement, similar to lin-5(RNAi) embryos. However, we observed transient regions of DHC-1 enrichment in cortical patches during late anaphase. These patches were most pronounced at the posterior cortex during spindle rocking and often followed the oscillatory behavior of the spindle poles | |||
| Expr2040935 | Translational efficiency and RNA abundance/Ribosome occupancy across early embryonic stages (1-cell to 8-cell). For each developmental stage, translational efficiency was calculated as the ratio between ribosome footprint reads and mRNA abundance after normalization. A detailed description of the experimental methods and analysis can be found in: Shukla Y, Ghatpande V, Hu CF, Dickinson DJ, Cenik C. Landscape and regulation of mRNA translation in the early C. elegans embryo. Cell Rep. 2025 June 24;44(6):115778. doi: 10.1016/j.celrep.2025.115778. PMID: 40450690 | |||
| Expr1157291 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015 | |||
| Expr13343 | We examined the subcellular localization of DHC-1 with a GFP::DHC-1 transgene expressed in DA9, and found that it is enriched at the dendrite terminal. GFP::DHC-1 is localized to the cytoplasm. | |||
| Expr15124 |
59 GO Annotation
| Annotation Extension | Qualifier |
|---|---|
| enables | |
| enables | |
| enables | |
| involved_in | |
| enables | |
| enables | |
| enables | |
| enables | |
| enables | |
| enables | |
| results_in_maturation_of(WBbt:0005270),part_of(GO:0002164) | involved_in |
| involved_in | |
| involved_in | |
| involved_in | |
| involved_in | |
| involved_in | |
| involved_in | |
| involved_in | |
| involved_in | |
| involved_in | |
| involved_in | |
| involved_in | |
| involved_in | |
| involved_in | |
| involved_in | |
| involved_in | |
| involved_in | |
| involved_in | |
| involved_in | |
| involved_in |
5 Homologues
| Type |
|---|
| least diverged orthologue |
| least diverged orthologue |
| least diverged orthologue |
| least diverged orthologue |
| least diverged orthologue |
59 Ontology Annotations
| Annotation Extension | Qualifier |
|---|---|
| enables | |
| enables | |
| enables | |
| involved_in | |
| enables | |
| enables | |
| enables | |
| enables | |
| enables | |
| enables | |
| results_in_maturation_of(WBbt:0005270),part_of(GO:0002164) | involved_in |
| involved_in | |
| involved_in | |
| involved_in | |
| involved_in | |
| involved_in | |
| involved_in | |
| involved_in | |
| involved_in | |
| involved_in | |
| involved_in | |
| involved_in | |
| involved_in | |
| involved_in | |
| involved_in | |
| involved_in | |
| involved_in | |
| involved_in | |
| involved_in | |
| involved_in |
20 Strains
1 Upstream Intergenic Region
| WormBase ID | Name | Sequence Name | Length (nt) | Chromosome Location | Organism |
|---|---|---|---|---|---|
| intergenic_region_chrI_4385219..4386784 | 1566 | I: 4385219-4386784 | Caenorhabditis elegans |
