Genomics
16 Transcripts
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:C09D1.1a.1 | C09D1.1a.1 |
20769
 |
I: 4035702-4078806 |
| Transcript:C09D1.1e.1 | C09D1.1e.1 |
17979
|
I: 4035893-4078127 |
| Transcript:C09D1.1l.1 | C09D1.1l.1 |
19833
|
I: 4035893-4078127 |
| Transcript:C09D1.1o.1 | C09D1.1o.1 |
17739
|
I: 4035893-4078127 |
| Transcript:C09D1.1f.1 | C09D1.1f.1 |
22326
|
I: 4035893-4090427 |
| Transcript:C09D1.1k.1 | C09D1.1k.1 |
24180
|
I: 4035893-4090427 |
| Transcript:C09D1.1m.1 | C09D1.1m.1 |
22527
|
I: 4035893-4090427 |
| Transcript:C09D1.1n.1 | C09D1.1n.1 |
22086
|
I: 4035893-4090427 |
| Transcript:C09D1.1b.1 | C09D1.1b.1 |
24703
|
I: 4035893-4090884 |
| Transcript:C09D1.1g.1 | C09D1.1g.1 |
22827
|
I: 4047136-4090427 |
| Transcript:C09D1.1h.1 | C09D1.1h.1 |
21108
|
I: 4047136-4090427 |
| Transcript:C09D1.1i.1 | C09D1.1i.1 |
22761
|
I: 4047136-4090427 |
| Transcript:C09D1.1j.1 | C09D1.1j.1 |
20907
|
I: 4047136-4090427 |
| Transcript:C09D1.1p.1 | C09D1.1p.1 |
20667
|
I: 4047136-4090427 |
| Transcript:C09D1.1d.1 | C09D1.1d.1 |
4784
|
I: 4080539-4090885 |
| Transcript:C09D1.1c.1 | C09D1.1c.1 |
4734
|
I: 4081507-4090884 |
Other
16 CDSs
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| CDS:C09D1.1a | C09D1.1a |
19899
|
I: 4035893-4035942 |
| CDS:C09D1.1o | C09D1.1o |
17739
|
I: 4035893-4035942 |
| CDS:C09D1.1n | C09D1.1n |
22086
|
I: 4035893-4035942 |
| CDS:C09D1.1b | C09D1.1b |
24246
|
I: 4035893-4035942 |
| CDS:C09D1.1h | C09D1.1h |
21108
|
I: 4047136-4047214 |
| CDS:C09D1.1j | C09D1.1j |
20907
|
I: 4047136-4047214 |
| CDS:C09D1.1p | C09D1.1p |
20667
|
I: 4047136-4047214 |
| CDS:C09D1.1d | C09D1.1d |
4191
|
I: 4080674-4080705 |
| CDS:C09D1.1c | C09D1.1c |
4182
|
I: 4081602-4081624 |
| CDS:C09D1.1e | C09D1.1e |
17979
|
I: 4035893-4035942 |
| CDS:C09D1.1f | C09D1.1f |
22326
|
I: 4035893-4035942 |
| CDS:C09D1.1g | C09D1.1g |
22827
|
I: 4047136-4047214 |
| CDS:C09D1.1i | C09D1.1i |
22761
|
I: 4047136-4047214 |
| CDS:C09D1.1k | C09D1.1k |
24180
|
I: 4035893-4035942 |
| CDS:C09D1.1l | C09D1.1l |
19833
|
I: 4035893-4035942 |
| CDS:C09D1.1m | C09D1.1m |
22527
|
I: 4035893-4035942 |
25 RNAi Result
812 Allele
| Public Name |
|---|
| gk962706 |
| gk963902 |
| gk964159 |
| otn9299 |
| otn9300 |
| WBVar00243152 |
| WBVar01431288 |
| WBVar01431290 |
| WBVar01431292 |
| WBVar01431291 |
| WBVar01431283 |
| WBVar01431281 |
| WBVar01694749 |
| st79 |
| st85 |
| st515 |
| su75 |
| su227 |
| su240 |
| tm752 |
| gk763030 |
| gk841461 |
| gk584872 |
| gk641189 |
| gk766935 |
| gk810593 |
| gk930752 |
| gk491378 |
| gk466428 |
| gk924127 |
1 Chromosome Location
|
Feature . Primary Identifier |
Start | End | Strand |
|---|---|---|---|
| WBGene00006820 | 4035702 | 4090885 | 1 |
4 Data Sets
| Name | URL |
|---|---|
| WormBaseAcedbConverter | |
| GO Annotation data set | |
| C. elegans genomic annotations (GFF3 Gene) | |
| Panther orthologue and paralogue predictions |
1 Downstream Intergenic Region
| WormBase ID | Name | Sequence Name | Length (nt) | Chromosome Location | Organism |
|---|---|---|---|---|---|
| intergenic_region_chrI_4090886..4094159 | 3274 | I: 4090886-4094159 | Caenorhabditis elegans |
267 Expression Clusters
| Regulated By Treatment | Description | Algorithm | Primary Identifier |
|---|---|---|---|
| oocyte proteins identified by two or more unique peptides during proteomics study. | In the pooled data set, 1453 C. elegans proteins were identified with a probability >= 0.9 according to ProteinProphet, of which 1165 proteins were identified by more than one unique peptide. | WBPaper00038289:oocyte_protein | |
| Genes with expression altered >= 3-fold in dpy-10(e128) mutants. | Data across the wild type series was analyzed using the Significance analysis of Microarrays (SAM) algorithm (to calculate the False Discovery Rate (FDR)). | WBPaper00035873:dpy-10_regulated | |
| Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons. | DESeq. False discovry rate (FDR) < 0.1. | WBPaper00048988:neuron_expressed | |
| Transcripts that showed significantly increased expression glp-1(e2141); TU3401 animals comparing to in TU3401 animals. | Fold change > 2, FDR < 0.01. | WBPaper00065993:glp-1(e2141)_upregulated | |
| adult vs dauer larva | Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C. | N.A. | WBPaper00050488:adult_vs_dauer_regulated_N2_20C |
| TGF- Dauer pathway adult transcriptional targets. Results obtained by comparing the microarray results of the dauer-constitutive mutants daf-7(e1372), daf-7(m62), and daf-1(m40) with dauer-defective mutants daf-3(mgDf90), daf-5(e1386), and daf-7(e1372);daf-3(mgDf90) double mutants at the permissive temperature, 20C, on the first day of adulthood. | SAM | WBPaper00031040:TGF-beta_adult_upregulated | |
| Osmotic stress | Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when food was present | DESeq(version 1.10.1), FDR < 0.05. | WBPaper00050726:OsmoticStress_regulated_Food |
| Transcripts that showed significantly decreased expression in eat-2(ad465) comparing to in N2. | DESeq2 1.30.1, fold change > 2, FDR < 0.05. | WBPaper00066890:eat-2(ad465)_downregulated | |
| Transcripts that showed significantly increased expression in eft-2(RNAi) animals at N2 background. | DESeq2, fold change > 2 and p-value < 0.01. | WBPaper00067953:eft-2(RNAi)_upregulated_N2 | |
| Transcripts that showed significantly increased expression in eft-2(RNAi) animals at zip-2(tm4248) background. | DESeq2, fold change > 2 and p-value < 0.01. | WBPaper00067953:eft-2(RNAi)_upregulated_zip-2(tm4248) | |
| Transcripts that showed significantly increased expression in eif-2alpha(RNAi) animals at N2 background. | DESeq2, fold change > 2 and p-value < 0.01. | WBPaper00067953:eif-2alpha(RNAi)_upregulated_N2 | |
| Transcripts that showed significantly increased expression in eif-2alpha(RNAi) animals at zip-2(tm4248) background. | DESeq2, fold change > 2 and p-value < 0.01. | WBPaper00067953:eif-2alpha(RNAi)_upregulated_zip-2(tm4248) | |
| Transcripts expressed in the epithelial tissues surrounding the pharynx that includes the arcade and intestinal valve (AIV) cells, according to PAT-Seq analysis using Pbath-15-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:arcade_intestinal-valve_expressed | |
| Transcripts expressed in body muscle, according to PAT-Seq analysis using Pmyo-3-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:body-muscle_expressed | |
| Transcripts expressed in GABAergic neuron, according to PAT-Seq analysis using Punc-47-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:GABAergic-neuron_expressed | |
| Proteins interacting with NHR-49-GFP according to co-IP and LC-MS. | N.A. | WBPaper00064071:NHR-49_interacting | |
| Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:hypodermis_expressed | |
| Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:intestine_expressed | |
| Transcripts expressed in NMDA neuron, according to PAT-Seq analysis using Pnmr-1-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:NMDA-neuron_expressed | |
| Transcripts expressed in pharynx, according to PAT-Seq analysis using Pmyo-2-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:pharynx_expressed | |
| Transcripts that showed significantly decreased expression at 5-days-post L4 adult N2 hermaphrodites comparing to 1-day-post L4 adult N2 hermaphrodites. | DESeq2, fold change > 2, FDR < 0.05 | WBPaper00065835:Day5_vs_Day1_downregulated | |
| Genes with expression level regulated by genotype (N2 vs CB4856) and age at old adults stage (214 hours at 24 centigrade). | For model 2, authors used 100 permutations to estimate the FDR threshold. Per permutation, genotypes and ages were independently randomly distributed, keeping the among-gene structure intact. Then for each spot (23,232) on the array, model 2 was tested. The obtained P-values were used to estimate a threshold for each of the explanatory factors. Authors also used a genome-wide threshold of -log10 P-value = 2, which resembles an FDR of 0.072 and 0.060 for marker and the interaction age-marker for the developing worms and FDR of 0.050 and 0.065 for marker and age-marker for the aging worms. For the physiological age effect, authors used a log10 P-value = 8 in developing worms (0.012 FDR) and -log10 P-value = 6 (0.032 FDR). | WBPaper00040858:eQTL_age_regulated_aging | |
| Transcripts expressed in seam cells, according to PAT-Seq analysis using Pgrd-10-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:seam_expressed | |
| Transcripts that showed significantly decreased expression at 11-days-post L4 adult N2 hermaphrodites comparing to 1-day-post L4 adult N2 hermaphrodites. | DESeq2, fold change > 2, FDR < 0.05 | WBPaper00065835:Day11_vs_Day1_downregulated | |
| Transcripts that showed significantly decreased expression in day 3 adult hermaphrodite comparing to in L4 larva daf-16(mu86);glp-1(e2141) animals. | Fold change > 2, FDR < 0.05 | WBPaper00064088:Day-3-adult_vs_L4_downregulated_daf-16(mu86);glp-1(e2141) | |
| Transcripts that showed significantly decreased expression in day 3 adult hermaphrodite comparing to in L4 larva glp-1(e2141) animals. | Fold change > 2, FDR < 0.05 | WBPaper00064088:Day-3-adult_vs_L4_downregulated_glp-1(e2141) | |
| Transcripts expressed in vulva. | FPKM >= 1. | WBPaper00064122:vulva_transcriptome | |
| Bacteria: Pseudomonas donghuensis HYS | Transcripts that showed significantly increased expression after 24 hours of infection by Pseudomonas donghuensis HYS with deletion of ferric uptake regulator (FUR), comparing to control animals exposed to OP50. | DESeq2, fold change > 2, FDR < 0.05. | WBPaper00068216:FUR_vs_OP50_upregulated |
| Bacteria infection: Bacillus thuringiensis | mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 10 mix) vs BT407 12h), according to RNAseq. | Cuffdiff, ajusted p-value < 0.01. | WBPaper00046497:B.thuringiensis_0.1mix_downregulated_12h |
| Bacteria infection: Bacillus thuringiensis | mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 2 mix) vs BT407 6h), according to RNAseq. | Cuffdiff, ajusted p-value < 0.01. | WBPaper00046497:B.thuringiensis_0.5mix_downregulated_6h |
15 Expression Patterns
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| Expr4551 | Expression of major cytoskeletal proteins were detected in the myoepithelial sheath, and, interestingly, some of them were also expressed in other parts of the somatic gonad. | |||
| Strain: BC12115 | [C24G7.5::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [ACACTACCCGTTTGCTCAATTT] 3' and primer B 5' [ATGAGCTTCTTCTCTTAGCTTTGC] 3'. | Expr5331 | Adult Expression: body wall muscle; unidentified cells; Larval Expression: body wall muscle; unidentified cells; | |
| Strain: BC12402 | [F28F5.4::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [ATAAAAACTGGCGCACCTATTAAG] 3' and primer B 5' [TTGTGGATTATACGGCGGA] 3'. | Expr5907 | Adult Expression: pharynx; Larval Expression: pharynx; unidentified cells in tail ; | |
| No detailed description on expression pattern in other tissue or life stages.. Picture: N.A. | Expr8742 | Not expressed in gonad. | ||
| Expr2036053 | Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans). | |||
| Picture: Figure 6. | Expr8552 | Co-localization of LIM-9 and the interkinase region of UNC-89 was observed at the M lines in C. elegans body wall muscle. | ||
| Expr1032885 | Tiling arrays expression graphs | |||
| Expr3083 | unc-89-A and -B are expressed in body-wall, pharyngeal and vulval muscles, unc-89-C is expressed in body-wall and vulval muscles (but not in the pharynx), and unc-89-D is expressed in only a few cells: vulval, intestinal, anal depressor and anal sphincter muscles. The identity of the anal depressor muscle was verified by examining expression of unc-89-D::GFP in adult males, which are known not to contain this muscle. Although all three promoters direct expression in vulval muscles, only the promoter for unc-89-D drives expression in the enteric muscles. | |||
| Expr1559 | Both antibodies localize to the pharyngeal muscle. | UNC-89 protein localize to the middle of A band in muscle cells. | ||
| Expr1021855 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 | |||
| Original chronogram file: chronogram.1335.xml | [F28F5.4:gfp] transcriptional fusion. | Chronogram315 | ||
| Original chronogram file: chronogram.1332.xml | [C09D1.1:gfp] transcriptional fusion. | Chronogram312 | ||
| Expr1144248 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015 | |||
| Expr2017917 | Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans). | |||
| Expr11966 | In wild-type embryos, UNC-89 is present in nascent M lines. |
41 GO Annotation
| Annotation Extension | Qualifier |
|---|---|
| has_input(WB:WBGene00004357) | enables |
| enables | |
| enables | |
| NOT|involved_in | |
| NOT|enables | |
| enables | |
| enables | |
| enables | |
| enables | |
| enables | |
| enables | |
| enables | |
| enables | |
| involved_in | |
| involved_in | |
| involved_in | |
| involved_in | |
| has_input(WB:WBGene00003183) | involved_in |
| has_input(WB:WBGene00006754),occurs_in(GO:0031672) | involved_in |
| involved_in | |
| involved_in | |
| involved_in | |
| involved_in | |
| involved_in | |
| occurs_in(WBbt:0005813) | involved_in |
| involved_in | |
| involved_in | |
| involved_in | |
| involved_in | |
| located_in |
40 Homologues
| Type |
|---|
| orthologue |
| orthologue |
| orthologue |
| orthologue |
| orthologue |
| orthologue |
| orthologue |
| orthologue |
| orthologue |
| orthologue |
| orthologue |
| orthologue |
| orthologue |
| orthologue |
| orthologue |
| orthologue |
| orthologue |
| orthologue |
| orthologue |
| orthologue |
| orthologue |
| orthologue |
| orthologue |
| orthologue |
| orthologue |
| orthologue |
| orthologue |
| orthologue |
| orthologue |
| orthologue |
41 Ontology Annotations
| Annotation Extension | Qualifier |
|---|---|
| has_input(WB:WBGene00004357) | enables |
| enables | |
| enables | |
| NOT|involved_in | |
| NOT|enables | |
| enables | |
| enables | |
| enables | |
| enables | |
| enables | |
| enables | |
| enables | |
| enables | |
| involved_in | |
| involved_in | |
| involved_in | |
| involved_in | |
| has_input(WB:WBGene00003183) | involved_in |
| has_input(WB:WBGene00006754),occurs_in(GO:0031672) | involved_in |
| involved_in | |
| involved_in | |
| involved_in | |
| involved_in | |
| involved_in | |
| occurs_in(WBbt:0005813) | involved_in |
| involved_in | |
| involved_in | |
| involved_in | |
| involved_in | |
| located_in |
1 Upstream Intergenic Region
| WormBase ID | Name | Sequence Name | Length (nt) | Chromosome Location | Organism |
|---|---|---|---|---|---|
| intergenic_region_chrI_4031740..4035701 | 3962 | I: 4031740-4035701 | Caenorhabditis elegans |
