WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00004888 Gene Name  smo-1
Sequence Name  ? K12C11.2 Brief Description  smo-1 encodes the C. elegans ortholog of SUMO, a small ubiquitin-like moiety that, when attached to protein substrates, regulates their subcellular localization and activity; smo-1 is an essential gene: loss of its activity results in embryonic and larval lethality; in addition, smo-1 mutants have defects in synaptonemal complex disassembly and bivalent formation, enhance meiotic defects of zhp-3::gfp mutants and show mislocalization of ZHP-3 in late pachytene; smo-1 is also required for reproductive system development, where its target may be the LIN-11 LIM homeodomain protein.
Organism  Caenorhabditis elegans Automated Description  Enables identical protein binding activity. Involved in several processes, including chromosome organization; multicellular organismal locomotion; and muscle cell cellular homeostasis. Predicted to be located in PML body. Expressed in several structures, including P3.p hermaphrodite; P4.p hermaphrodite; P8.p hermaphrodite; hermaphrodite somatic gonadal cell; and ventral nerve cord. Human ortholog(s) of this gene implicated in orofacial cleft 10. Is an ortholog of human SUMO1 (small ubiquitin like modifier 1).
Biotype  SO:0001217 Genetic Position  I :-14.6998 ±0.008159
Length (nt)  ? 588
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene is in one list:
metrics_list_union (10192)

1 Organism

Name Taxon Id
Caenorhabditis elegans 6239

1 Synonyms

Value
WBGene00004888

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:K12C11.2.1 K12C11.2.1 482   I: 1340678-1341265
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:K12C11.2 K12C11.2 276   I: 1340703-1340768

91 RNAi Result

WormBase ID
WBRNAi00082812
WBRNAi00034310
WBRNAi00025954
WBRNAi00066959
WBRNAi00067110
WBRNAi00067146
WBRNAi00067150
WBRNAi00067190
WBRNAi00067775
WBRNAi00050648
WBRNAi00000082
WBRNAi00061300
WBRNAi00099938
WBRNAi00100450
WBRNAi00094180
WBRNAi00111578
WBRNAi00108414
WBRNAi00061301
WBRNAi00061302
WBRNAi00061303
WBRNAi00061304
WBRNAi00061305
WBRNAi00069927
WBRNAi00069943
WBRNAi00069951
WBRNAi00069956
WBRNAi00069967
WBRNAi00069973
WBRNAi00069976
WBRNAi00070017

13 Allele

Public Name
gk963902
gk963630
gk963701
kry53
kry55
gk938986
ok359
gk938987
zh140
gk102906
gk702291
WBVar01555591
gk630875

1 Chromosome

WormBase ID Organism Length (nt)
I Caenorhabditis elegans 15072434  

1 Chromosome Location


Feature . Primary Identifier 		Start End Strand
WBGene00004888 1340678 1341265 1

4 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  
C. elegans genomic annotations (GFF3 Gene)  
Panther orthologue and paralogue predictions  

1 Downstream Intergenic Region

WormBase ID Name Sequence Name Length (nt) Chromosome Location Organism
intergenic_region_chrI_1341266..1341271   6 I: 1341266-1341271 Caenorhabditis elegans

183 Expression Clusters

Regulated By Treatment Description Algorithm Primary Identifier
  Transcripts of coding genes that showed significantly decreased expression in muscle. DESeq2 (version 1.24.0). Transcripts with a false-discovery rate adjusted p-value less than 0.05 were considered significantly differentially expressed. WBPaper00062325:muscle_depleted_coding-RNA
adult vs dauer larva Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C. N.A. WBPaper00050488:adult_vs_dauer_regulated_N2_20C
  Transcripts enriched in ASG according to single cell RNAseq. Genes that pass the Bonferroni threshold for multiple comparisons (q < 0.05) are significantly enriched. WBPaper00061651:ASG_enriched
  Transcripts that showed significantly increased expression after animals were treated with 50uM Rifampicin and 250uM Allantoin from day 1 to day 3 adult hermaphradite. DESeq2(v1.14.1), fold change > 2, p-value < 0.05 WBPaper00055354:Rifampicin-Allantoin_upregulated
  Transcripts that showed significantly higher expression in somatic gonad precursor cells (SGP) vs. head mesodermal cells (hmc). DESeq2, fold change >= 2, FDR <= 0.01. WBPaper00056826:SGP_biased
Bacteria infection: Enterococcus faecalis OG1RF. Exposure for 16 hours. Transcripts that showed significantly decreased expression in N2 after animals were exposed to E. faecalis OG1RF for 16 hours comparing to exposure to E. Coli OP50. Cuffcompare and Cuffdiff WBPaper00056090:E.faecalis_downregulated_N2
  Transcripts expressed in the epithelial tissues surrounding the pharynx that includes the arcade and intestinal valve (AIV) cells, according to PAT-Seq analysis using Pbath-15-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:arcade_intestinal-valve_expressed
  Transcripts expressed in GABAergic neuron, according to PAT-Seq analysis using Punc-47-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:GABAergic-neuron_expressed
  Proteins interacting with NHR-49-GFP according to co-IP and LC-MS. N.A. WBPaper00064071:NHR-49_interacting
  Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:hypodermis_expressed
  Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:intestine_expressed
  Transcripts expressed in NMDA neuron, according to PAT-Seq analysis using Pnmr-1-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:NMDA-neuron_expressed
  Transcripts expressed in pharynx, according to PAT-Seq analysis using Pmyo-2-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:pharynx_expressed
  Genes with expression level regulated by genotype (N2 vs CB4856) and age at L3 larva and Late reproduction stage (96 hours at 24 centigrade). For model 2, authors used 100 permutations to estimate the FDR threshold. Per permutation, genotypes and ages were independently randomly distributed, keeping the among-gene structure intact. Then for each spot (23,232) on the array, model 2 was tested. The obtained P-values were used to estimate a threshold for each of the explanatory factors. Authors also used a genome-wide threshold of -log10 P-value = 2, which resembles an FDR of 0.072 and 0.060 for marker and the interaction age-marker for the developing worms and FDR of 0.050 and 0.065 for marker and age-marker for the aging worms. For the physiological age effect, authors used a log10 P-value = 8 in developing worms (0.012 FDR) and -log10 P-value = 6 (0.032 FDR). WBPaper00040858:eQTL_age_regulated_developing
  Transcripts expressed in seam cells, according to PAT-Seq analysis using Pgrd-10-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:seam_expressed
  Genes with expression level regulated by genotype (N2 vs CB4856) at L3 larva and Late reproduction stage (96 hours at 24 centigrade). For model 2, authors used 100 permutations to estimate the FDR threshold. Per permutation, genotypes and ages were independently randomly distributed, keeping the among-gene structure intact. Then for each spot (23,232) on the array, model 2 was tested. The obtained P-values were used to estimate a threshold for each of the explanatory factors. Authors also used a genome-wide threshold of -log10 P-value = 2, which resembles an FDR of 0.072 and 0.060 for marker and the interaction age-marker for the developing worms and FDR of 0.050 and 0.065 for marker and age-marker for the aging worms. For the physiological age effect, authors used a log10 P-value = 8 in developing worms (0.012 FDR) and -log10 P-value = 6 (0.032 FDR). WBPaper00040858:eQTL_regulated_developing
  Transcripts that showed significantly decreased expression in day 3 adult hermaphrodite comparing to in L4 larva daf-16(mu86);glp-1(e2141) animals. Fold change > 2, FDR < 0.05 WBPaper00064088:Day-3-adult_vs_L4_downregulated_daf-16(mu86);glp-1(e2141)
  Transcripts that showed significantly decreased expression in day 3 adult hermaphrodite comparing to in L4 larva glp-1(e2141) animals. Fold change > 2, FDR < 0.05 WBPaper00064088:Day-3-adult_vs_L4_downregulated_glp-1(e2141)
Bacteria: Pseudomonas donghuensis HYS Transcripts that showed significantly increased expression after 24 hours of infection by Pseudomonas donghuensis HYS with deletion of ferric uptake regulator (FUR), comparing to control animals exposed to HYS. DESeq2, fold change > 2, FDR < 0.05. WBPaper00068216:FUR_vs_HYS_upregulated
Bacteria: Pseudomonas donghuensis HYS Transcripts that showed significantly decreased expression after 24 hours of infection by Pseudomonas donghuensis HYS, comparing to control animals exposed to OP50. DESeq2, fold change > 2, FDR < 0.05. WBPaper00068216:HYS_vs_OP50_downregulated
Bacteria infection: Bacillus thuringiensis mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 10 mix) vs BT407 6h), according to RNAseq. Cuffdiff, ajusted p-value < 0.01. WBPaper00046497:B.thuringiensis_0.1mix_downregulated_6h
Bacteria infection: Bacillus thuringiensis mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 10 mix) vs BT407 12h), according to RNAseq. Cuffdiff, ajusted p-value < 0.01. WBPaper00046497:B.thuringiensis_0.1mix_downregulated_12h
  Transcripts detected in germline isolated from day-1 adult hermaphrodite animals. All three experiments have CPM >= 1. WBPaper00067147:germline_expressed
  Transcripts that showed significantly increased expression after 24-hour exposure to 10uM benzyl butyl phthalate (BBP) in col-121(nx3) animals. DESeq2v1.38.3, FDR < 0.05 WBPaper00067417:benzyl-butyl-phthalate_regulated
Bacteria infection: Staphylococcus aureus Transcripts that showed significantly decreased expression in animals experimentally colonised by a wild microbiota community and infected by the widespread animal pathogen, Staphylococcus aureus, comparing to animals colonized by microbiota but not infected by pathogen. DeSeq2 (v. 1.42.0), Wald analyses testing against a null hypothesis of < |1.5|-fold change in gene expression between treatments (BenjaminiHochberg adjusted false detection rate of p <= 0.05. WBPaper00067479:Microbiota-Pathogen_vs_Microbiota_downregulated
  Transcripts that showed significantly decreased expression in daf-16(mgDf50) comparing to in N2 at L1 larva stage. DESeq v1.20.0 was used to analyze differential gene expression. Transcripts with adjusted p-value < 0.05 were considered differentialled expressed. WBPaper00048971:daf-16(mgDf50)_downregulated_L1
  Transcripts detected in body muscle nuclei according to a nuclear FACS-based strategy. Cufflinks WBPaper00065120:body-muscle-transcriptome
Bacteria infection: Pseudomonas aeruginosa PA14. 24 hours of exposure at 25C. Transcripts that showed significantly increased expression in N2 animals with 24 hours of exposure to P. aeruginosa PA14 for 24 hrs at 25C, comparing to N2 animals without exposure to PA14. DESeq2, fold change > 2, FDR < 0.05. WBPaper00058948:PA14_upregulated
Gamma irradiation 100 mGY per hour for 72 hours since L1 larva. Transcripts that showed significantly increased expression after exposure to 100mGy per hour gamma irradiation from L1 to day 1 adult hermaphrodite stage. DESeq2, FDR <= 0.05, log2 fold change >= 0.3 or <= -0.3. WBPaper00058958:100mGy-irradiation-72h_upregulated
  Proteins that showed significantly decreased expression after 1-day-old wild type adults were exposed to cisplatin (300ug per mL) for 6 hours. The differential expression analysis was performed in R. Differentially expressed proteins were identified by using a two-sided t-test on log-transformed data. WBPaper00065373:Cisplatin_downregulated_WT

11 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
    Expr2034154 Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).  
Also expressed in (comments from author) : No comments. Strain: BC15527 [smo-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [ATGAGACCTGACGATACCGC] 3' and primer B 5' [CGGCGATCGTTTATAGCG] 3'. Expr6394 Adult Expression: pharynx; pharyngeal-intestinal valve; intestine; rectal epithelium; Reproductive System; vulval muscle; spermatheca; gonad sheath cells; body wall muscle; hypodermis; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; lateral nerve cords; tail neurons; Larval Expression: pharynx; pharyngeal-intestinal valve; intestine; rectal epithelium; Reproductive System; developing vulva; developing spermatheca; body wall muscle; hypodermis; seam cells; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; lateral nerve cords; tail neurons;  
    Expr1032427 Tiling arrays expression graphs  
    Expr13766   SMO-1 localized to germline nuclei throughout prophase I.
    Expr3449 At the L4 stage, SMO-1::GFP marker was expressed in each of the 64 uterine cells, the somatic spermathecal cells, the sheath cells that cover the gonadal arms, the hypodermis, and seam cells. The two DTCs of the somatic gonad also expressed the transgene. At the early L3 stage, expression was detected in the six vulval precurcor cells (VPCs), and at the L4 stage SMO-1::GFP was found in all 22 vulval nuclei, as well as in the gonadal anchor cell (AC). The lack of germ cell expression could be attributed to germ-line silencing. Expression in embryos was detected as early as the gastrulation stage.  
    Expr1020726 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
Original chronogram file: chronogram.1632.xml [K12C11.2:gfp] transcriptional fusion. Chronogram603    
    Expr1154360 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015  
    Expr2015921 Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).  
    Expr2043041 Translational efficiency and RNA abundance/Ribosome occupancy across early embryonic stages (1-cell to 8-cell). For each developmental stage, translational efficiency was calculated as the ratio between ribosome footprint reads and mRNA abundance after normalization. A detailed description of the experimental methods and analysis can be found in: Shukla Y, Ghatpande V, Hu CF, Dickinson DJ, Cenik C. Landscape and regulation of mRNA translation in the early C. elegans embryo. Cell Rep. 2025 June 24;44(6):115778. doi: 10.1016/j.celrep.2025.115778. PMID: 40450690  
    Expr13970   SMO-1 localizes to the chromatin of germline nuclei and then to the axes of the bivalent short arms in late diakinesis stage oocytes.

55 GO Annotation

Annotation Extension Qualifier
has_input(WB:WBGene00001184)|has_input(WB:WBGene00006353) involved_in
  involved_in
has_input(WB:WBGene00003515),occurs_in(WBbt:0003675),part_of(GO:0046716) involved_in
has_input(WB:WBGene00003515),occurs_in(WBbt:0003675),part_of(GO:0046716) involved_in
happens_during(WBls:0000060),has_input(WB:WBGene00003515) involved_in
happens_during(WBls:0000060),has_input(WB:WBGene00003515) involved_in
happens_during(WBls:0000060),has_input(WB:WBGene00003515) involved_in
happens_during(WBls:0000060),has_input(WB:WBGene00003515) involved_in
  involved_in
  involved_in
  involved_in
  involved_in
happens_during(WBls:0000060) involved_in
happens_during(WBls:0000060) involved_in
happens_during(WBls:0000060) involved_in
happens_during(WBls:0000060) involved_in
  located_in
  located_in
  located_in
  located_in
  involved_in
  involved_in
  involved_in
  involved_in
  located_in
  located_in
  located_in
  located_in
  located_in
  located_in

6 Homologues

Type
orthologue
orthologue
orthologue
orthologue
least diverged orthologue
least diverged orthologue

1 Locations


Feature . Primary Identifier 		Start End Strand
WBGene00004888 1340678 1341265 1

55 Ontology Annotations

Annotation Extension Qualifier
has_input(WB:WBGene00001184)|has_input(WB:WBGene00006353) involved_in
  involved_in
has_input(WB:WBGene00003515),occurs_in(WBbt:0003675),part_of(GO:0046716) involved_in
has_input(WB:WBGene00003515),occurs_in(WBbt:0003675),part_of(GO:0046716) involved_in
happens_during(WBls:0000060),has_input(WB:WBGene00003515) involved_in
happens_during(WBls:0000060),has_input(WB:WBGene00003515) involved_in
happens_during(WBls:0000060),has_input(WB:WBGene00003515) involved_in
happens_during(WBls:0000060),has_input(WB:WBGene00003515) involved_in
  involved_in
  involved_in
  involved_in
  involved_in
happens_during(WBls:0000060) involved_in
happens_during(WBls:0000060) involved_in
happens_during(WBls:0000060) involved_in
happens_during(WBls:0000060) involved_in
  located_in
  located_in
  located_in
  located_in
  involved_in
  involved_in
  involved_in
  involved_in
  located_in
  located_in
  located_in
  located_in
  located_in
  located_in

2 Regulates Expr Cluster

Regulated By Treatment Description Algorithm Primary Identifier
  SUMO-conjugated worm proteins identified by affinity chromatography and mass spectrometry N.A. WBPaper00061478:SUMO-conjugated_protein
  Proteins that were modified by SUMO (smo-1). Using the strain RU86[smo-1(ok359); Is(psmo-1::smo-1gfp::3'UTRsmo-1] expressing HIS-GFP tagged SUMO, authors set up the purification of proteins modified by SUMO using immobilized metal ion affinity chromatography (IMAC). Proteins were considered as SUMOylated if they were identified in at least 3 independent experiments, each protein identified with at least two peptides, FDR below 1% and not present in any of the control purifications from wild-type N2 worms or present with raw intensity greater than 10 times than in control purifications. WBPaper00053615:SMO-1_target

1 Sequence

Length
588

1 Sequence Ontology Term

Identifier Name Description
gene  

5 Strains

WormBase ID
WBStrain00024026
WBStrain00024025
WBStrain00035570
WBStrain00050864
WBStrain00003532

1 Upstream Intergenic Region

WormBase ID Name Sequence Name Length (nt) Chromosome Location Organism
intergenic_region_chrI_1339774..1340677   904 I: 1339774-1340677 Caenorhabditis elegans