Genomics
2 Transcripts
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:F15A2.6b.1 | F15A2.6b.1 |
3430
 |
X: 13487552-13500668 |
| Transcript:F15A2.6a.1 | F15A2.6a.1 |
3388
|
X: 13487555-13500662 |
Other
2 CDSs
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| CDS:F15A2.6a | F15A2.6a |
2745
|
X: 13488088-13488172 |
| CDS:F15A2.6b | F15A2.6b |
2508
|
X: 13489453-13489466 |
290 Allele
| Public Name |
|---|
| gk964260 |
| gk964029 |
| gk962707 |
| gk964028 |
| gk963810 |
| gk963581 |
| WBVar01928366 |
| WBVar01928367 |
| WBVar01928368 |
| WBVar01928369 |
| WBVar01928370 |
| WBVar01928371 |
| WBVar01928372 |
| WBVar01928373 |
| WBVar01928374 |
| WBVar01928375 |
| WBVar01928376 |
| WBVar01928377 |
| WBVar01759929 |
| WBVar01759930 |
| WBVar01759932 |
| WBVar01759931 |
| WBVar01759934 |
| WBVar01759933 |
| WBVar01759936 |
| WBVar01759935 |
| WBVar01759938 |
| WBVar01759937 |
| WBVar01759939 |
| WBVar01759941 |
1 Chromosome Location
|
Feature . Primary Identifier |
Start | End | Strand |
|---|---|---|---|
| WBGene00004719 | 13487552 | 13500668 | -1 |
4 Data Sets
| Name | URL |
|---|---|
| WormBaseAcedbConverter | |
| GO Annotation data set | |
| C. elegans genomic annotations (GFF3 Gene) | |
| Panther orthologue and paralogue predictions |
1 Downstream Intergenic Region
| WormBase ID | Name | Sequence Name | Length (nt) | Chromosome Location | Organism |
|---|---|---|---|---|---|
| intergenic_region_chrX_13484914..13487551 | 2638 | X: 13484914-13487551 | Caenorhabditis elegans |
195 Expression Clusters
| Regulated By Treatment | Description | Algorithm | Primary Identifier |
|---|---|---|---|
| Transcripts that showed significantly increased expression in L1 neural cells comparing to in adult neural cells. | DESeq2 (v1.18.1) fold change > 2, P-adj<0.05, using BenjaminiHochberg correction. | WBPaper00060811:L1_vs_adult_upregulated_neural | |
| Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons. | DESeq. False discovry rate (FDR) < 0.1. | WBPaper00048988:neuron_expressed | |
| Genes significantly enriched (> 2x, FDR < 5%) in a particular cell-type versus a reference sample of all cells at the same stage. | A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. | WBPaper00037950:A-class-motor-neurons_larva_enriched | |
| Transcripts of coding genes that showed significantly decreased expression in muscle. | DESeq2 (version 1.24.0). Transcripts with a false-discovery rate adjusted p-value less than 0.05 were considered significantly differentially expressed. | WBPaper00062325:muscle_depleted_coding-RNA | |
| adult vs dauer larva | Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C. | N.A. | WBPaper00050488:adult_vs_dauer_regulated_N2_20C |
| Osmotic stress | Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when food was present | DESeq(version 1.10.1), FDR < 0.05. | WBPaper00050726:OsmoticStress_regulated_Food |
| Neuronally enriched transcripts according to a comparison of neuronal nuclei IP samples to total nuclei using isolation of nuclei from tagged specific cell types (INTACT) technology. | DESEQ2, fold change > 2 and FDR < 0.01. | WBPaper00062103:neuron_enriched | |
| Bacteria infection: Enterococcus faecalis | Genes with increased expression after 24 hours of infection by E.faecalis Fold changes shown are pathogen vs OP50. | For RNA-seq and tiling arrays, log2 fold changes between gene expression values of infected versus uninfected nematodes were calculated. For log2 fold changes > 0.00001 the values > 81.25th percentile were defined as up-regulated and for log2 fold changes < -0.00001 the values < 18.75th percentile were defined as down-regulated. | WBPaper00038438:E.faecalis_24hr_upregulated_TilingArray |
| Transcripts that showed significantly increased expression in eft-2(RNAi) animals at N2 background. | DESeq2, fold change > 2 and p-value < 0.01. | WBPaper00067953:eft-2(RNAi)_upregulated_N2 | |
| Transcripts that showed significantly increased expression in eft-2(RNAi) animals at zip-2(tm4248) background. | DESeq2, fold change > 2 and p-value < 0.01. | WBPaper00067953:eft-2(RNAi)_upregulated_zip-2(tm4248) | |
| Transcripts that showed significantly increased expression in eif-2alpha(RNAi) animals at N2 background. | DESeq2, fold change > 2 and p-value < 0.01. | WBPaper00067953:eif-2alpha(RNAi)_upregulated_N2 | |
| Transcripts that showed significantly increased expression in eif-2alpha(RNAi) animals at zip-2(tm4248) background. | DESeq2, fold change > 2 and p-value < 0.01. | WBPaper00067953:eif-2alpha(RNAi)_upregulated_zip-2(tm4248) | |
| Genes significantly enriched in NSM neurons (isolated by FACS) versus the reference, according to RNAseq analysis towards total RNA. | Gene expression quantification and differential expression was analyzed using cufflinks v2.2.1. Enriched contains only genes significantly enriched (differentially expressed >= 2.4 fold in total RNA or >= 3.2 fold in DSN treated total RNA) in the NSM neurons versus the reference. | WBPaper00045974:NSM_enriched_totalRNA_RNAseq | |
| Transcripts expressed in GABAergic neuron, according to PAT-Seq analysis using Punc-47-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:GABAergic-neuron_expressed | |
| Transcripts expressed in NMDA neuron, according to PAT-Seq analysis using Pnmr-1-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:NMDA-neuron_expressed | |
| Transcripts that showed significantly decreased expression in day 3 adult hermaphrodite comparing to in L4 larva daf-16(mu86);glp-1(e2141) animals. | Fold change > 2, FDR < 0.05 | WBPaper00064088:Day-3-adult_vs_L4_downregulated_daf-16(mu86);glp-1(e2141) | |
| Transcripts that showed significantly decreased expression in day 3 adult hermaphrodite comparing to in L4 larva glp-1(e2141) animals. | Fold change > 2, FDR < 0.05 | WBPaper00064088:Day-3-adult_vs_L4_downregulated_glp-1(e2141) | |
| Bacteria: Pseudomonas donghuensis HYS | Transcripts that showed significantly increased expression after 24 hours of infection by Pseudomonas donghuensis HYS with deletion of ferric uptake regulator (FUR), comparing to control animals exposed to OP50. | DESeq2, fold change > 2, FDR < 0.05. | WBPaper00068216:FUR_vs_OP50_upregulated |
| Transcripts that showed significantly increased expression in sin-3(tm1276) comparing to in N2. | DESeq2, fold change > 2, p-value < 0.01. | WBPaper00061203:sin-3(tm1276)_upregulated | |
| Transcripts that showed significantly increased expression after four-day-old young adult worms were placed on NGM plates seeded with OP50 in the presence 5% Agaro-oligosaccharides(AGO) for 24 h, comparing to animals grown in the absence of AGO. | Fold change > 2. | WBPaper00064306:Agaro-oligosaccharides_upregulated | |
| Transcripts that showed significantly increased expression in exos-8(RNAi) animals. | fold change > 2, FDR < 0.05 | WBPaper00068292:exos-8(RNAi)_upregulated | |
| Transcripts that showed significantly increased expression in aak-1(tm1944);aak-2(ok524) animals comparing to in N2. | DEseq 1.18.0, adjusted p-value < 0.05. | WBPaper00056471:aak-1(tm1944);aak-2(ok524)_upregulated | |
| Genes that showed significantly increased expression in daf-2(e1370);hel-1(gk148684) comparing to in hel-1(gk148684) | To identify DEGs, Students t test and the log2 median ratio test were performed to compute t values and median ratios for all the annotated genes. The adjusted P values from each test were computed using an empirical distribution of the null hypothesis, which was obtained from random permutations of the samples. Finally, the adjusted P values from the individual tests were combined to compute the overall P values using Stouffers method , and genes with overall P < 0.05 and fold change > 1.5 were selected as DEGs. | WBPaper00047131:daf-2(e1370)_upregulated_hel-1(gk148684)-background | |
| Genes that showed significantly increased expression in daf-2(e1370) comparing to in N2. | To identify DEGs, Students t test and the log2 median ratio test were performed to compute t values and median ratios for all the annotated genes. The adjusted P values from each test were computed using an empirical distribution of the null hypothesis, which was obtained from random permutations of the samples. Finally, the adjusted P values from the individual tests were combined to compute the overall P values using Stouffers method , and genes with overall P < 0.05 and fold change > 1.5 were selected as DEGs. | WBPaper00047131:daf-2(e1370)_upregulated_N2-background | |
| Transcripts that showed significantly altered expression after 24 hour exposure to stavudine (d4T) starting at L1 lava stage. | DESeq | WBPaper00053302:stavudine_24h_regulated | |
| Transcripts that showed significantly decreased expression in sin-3(tm1276) comparing to in N2 at early embryo when there were only 3 -5 eggs in the adult. | DESeq2, fold change > 2, adjusted p-value < 0.01 | WBPaper00058598:sin-3(tm1276)_downregulated | |
| Transcripts depleted in purified oocyte P bodies comparing to in the whole animal. | DESeq2, FDR < 0.05, fold change > 2. | WBPaper00065975:P-body_vs_WholeAnimal_depleted | |
| Transcripts that showed significantly increased expression in hpk-1(pk1393) comparing to in N2 at adult day 2. | DESeq 2, fold change > 2, FDR < 0.05. | WBPaper00065581:hpk-1(pk1393)_upregulated | |
| Transcripts that showed significantly increased expression in hda-1(ne4752[3xFLAG-Degron-HDA-1]) in gonads dissected from 1-day old adult animals. | Salmon was used to map the mRNA-seq reads with the worm database WS268, and its output files were imported to DESeq2 in R. The differentially expressed genes were filtered by fold change more than 2 and adjusted p-value < 0.05. The scatter plots were generated by the plot function in R. | WBPaper00061479:hda-1(ne4752)_upregulated | |
| Transcripts that showed significantly increased expression in hda-2(ok1479) comparing to in N2 animals. | DESeq2 (version 1.28.1), FDR < 0.01, fold change > 2. | WBPaper00062159:hda-2(ok1479)_upregulated |
18 Expression Patterns
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| Picture: Fig 1 and Fig S1. | Expr4970 | Staining pattern within the synaptic region was nonidentical to but highly correlated with that of RAB-3. | ||
| Picture: Fig 1. | Expr4964 | Discrete localization to the presynaptic region of HSNL near the vulva. | ||
| Also expressed in (comments from author) : Embryo incomplete. To be updated. Strain: BC11135 | [sad-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [ACTTTGACCGGGTATTATGAAAAA] 3' and primer B 5' [ACTTTGCCCGATTGACGA] 3'. | Expr5763 | Adult Expression: Nervous System; nerve ring; ventral nerve cord; tail neurons; unidentified cells; Larval Expression: Nervous System; nerve ring; ventral nerve cord; tail neurons; unidentified cells; | |
| Strain: BC12688 | [sad-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [ACTTTGACCGGGTATTATGAAAAA] 3' and primer B 5' [ACTTTGCCCGATTGACGA] 3'. | Expr5764 | Adult Expression: Nervous System; nerve ring; ventral nerve cord; head neurons; neurons along body; tail neurons; Larval Expression: Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons; unidentified cells in body ; | |
| Expr14693 | A two-color splicing reporter for sad-1 in C. elegans revealed that many neurons express both the skipped and included isoforms. For example, motor neurons in the ventral nerve cord express both isoforms of sad-1. On the other hand, the ALM touch-sensing neuron expresses only the included isoform, while the BDU neuron, which is the sister cell to the ALM neuron, expresses only the skipped isoform. | |||
| Expr14694 | A two-color splicing reporter for sad-1 in C. elegans revealed that many neurons express both the skipped and included isoforms. For example, motor neurons in the ventral nerve cord express both isoforms of sad-1. On the other hand, the ALM touch-sensing neuron expresses only the included isoform, while the BDU neuron, which is the sister cell to the ALM neuron, expresses only the skipped isoform. | |||
| Original chronogram file: chronogram.103.xml | [F15A2.6:gfp] transcriptional fusion. | Chronogram36 | ||
| Expr1032327 | Tiling arrays expression graphs | |||
| Picture: Figure 6A. | Expr8337 | In the nervous system, GFP::SAD-1 expression was observed along the processes and in the cell bodies of body neurons. | ||
| Expr812 | In animals transgenic for psad-1GFP, fluorescence was seen in the entire nervous system beginning at late embryogenesis and continuing through adulthood. Observed no expression in any tissues outside of the nervous system. Within neurons, GFP fluorescence was uniformly distributed, indicating that the small portion of SAD-1 protein fused to GFP did not localize to a particular subcellular region. | Within neurons, GFP fluorescence was uniformly distributed. | ||
| Expr813 | Only weak expression of SAD-1 was visible in wild-type animals, but in animals overexpressing SAD-1 from the endogenous promoter SAD-1 immunoreactivity was present throughout the nervous system. As with psad-1GFP, expression was first seen in the late embryo. Observed no consistent anti-SAD-1 staining in sad-1(ky289) null animals,suggesting that the antibodies are specific for SAD-1 protein. The onset of sad-1 expression in the late embryo is consistent with a role for SAD-1 in synaptogenesis, as this is the time when many synapses are first made. | Fluorescence appeared as a combination of punctate and diffuse staining within the axon. | ||
| Both wild-type SAD-1 and this GFP fusion caused paralysis and other phenotypes when expressed at high concentrations, but at the lower concentrations examined in this experiment punc-115SAD-1::GFP did not cause locomotion defects. | Expr814 | SAD-1::GFP fluorescence was most prominent in the nerve ring and the ventral and dorsal cords, regions of the axon where the majority of synapses are made. Little or no staining was observed in the sensory dendrites or the axonal commissures, which are devoid of synapses. Weaker fluorescence was also visible in the neuronal cell bodies excluded from the nucleus. | Little or no staining was observed in the sensory dendrites or the axonal commissures, which are devoid of synapses. Weaker fluorescence was also visible in the neuronal cell bodies excluded from the nucleus. Fluorescence appeared as a combination of punctate and diffuse staining within the axon. | |
| Two-color splicing reporter. | Expr11972 | The neuronal serine/threonine protein kinase gene sad-1 encodes two isoforms that are coexpressed in most neurons in the head and ventral nerve cord, but only one isoform is expressed in a cluster of oxygen-sensing cells, while only the other isoform is expressed in a nearby cluster of lateral mechanosensory neurons. | ||
| Expr2015578 | Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans). | |||
| Expr1025531 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 | |||
| Expr2033813 | Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans). | |||
| Expr3555 | Synaptic expression, co-localized with SNB-1::RFP. | |||
| Expr1148645 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015 |
33 GO Annotation
| Annotation Extension | Qualifier |
|---|---|
| enables | |
| enables | |
| enables | |
| enables | |
| enables | |
| enables | |
| enables | |
| enables | |
| enables | |
| enables | |
| enables | |
| enables | |
| enables | |
| enables | |
| involved_in | |
| involved_in | |
| involved_in | |
| involved_in | |
| involved_in | |
| involved_in | |
| involved_in | |
| enables | |
| located_in | |
| involved_in | |
| involved_in | |
| involved_in | |
| involved_in | |
| involved_in | |
| involved_in | |
| involved_in |
10 Homologues
| Type |
|---|
| orthologue |
| orthologue |
| orthologue |
| least diverged orthologue |
| least diverged orthologue |
| least diverged orthologue |
| least diverged orthologue |
| orthologue |
| orthologue |
| least diverged orthologue |
33 Ontology Annotations
| Annotation Extension | Qualifier |
|---|---|
| enables | |
| enables | |
| enables | |
| enables | |
| enables | |
| enables | |
| enables | |
| enables | |
| enables | |
| enables | |
| enables | |
| enables | |
| enables | |
| enables | |
| involved_in | |
| involved_in | |
| involved_in | |
| involved_in | |
| involved_in | |
| involved_in | |
| involved_in | |
| enables | |
| located_in | |
| involved_in | |
| involved_in | |
| involved_in | |
| involved_in | |
| involved_in | |
| involved_in | |
| involved_in |
1 Upstream Intergenic Region
| WormBase ID | Name | Sequence Name | Length (nt) | Chromosome Location | Organism |
|---|---|---|---|---|---|
| intergenic_region_chrX_13500669..13504091 | 3423 | X: 13500669-13504091 | Caenorhabditis elegans |
