Genomics
6 Transcripts
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:W09B6.1a.1 | W09B6.1a.1 |
6840
 |
II: 1136785-1152701 |
| Transcript:W09B6.1c.1 | W09B6.1c.1 |
6498
|
II: 1136801-1152375 |
| Transcript:W09B6.1a.3 | W09B6.1a.3 |
6604
|
II: 1140339-1152665 |
| Transcript:W09B6.1a.4 | W09B6.1a.4 |
6531
|
II: 1143900-1152705 |
| Transcript:W09B6.1a.2 | W09B6.1a.2 |
6453
|
II: 1143908-1152665 |
| Transcript:W09B6.1b.1 | W09B6.1b.1 |
2442
|
II: 1143936-1152375 |
Other
3 CDSs
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| CDS:W09B6.1c | W09B6.1c |
6498
|
II: 1136801-1136858 |
| CDS:W09B6.1b | W09B6.1b |
2442
|
II: 1143936-1143989 |
| CDS:W09B6.1a | W09B6.1a |
6165
|
II: 1143936-1143989 |
24 RNAi Result
336 Allele
| Public Name |
|---|
| gk964317 |
| gk963801 |
| WBVar01435783 |
| WBVar01435780 |
| WBVar01435782 |
| WBVar01435781 |
| gk133085 |
| gk133086 |
| gk133083 |
| gk133084 |
| gk133081 |
| gk133082 |
| gk133090 |
| gk133091 |
| gk133088 |
| gk133089 |
| gk133087 |
| gk133094 |
| gk133092 |
| gk133093 |
| gk133068 |
| gk133069 |
| gk133076 |
| gk133074 |
| gk133075 |
| gk133072 |
| gk133073 |
| gk133070 |
| gk133071 |
| gk133079 |
1 Chromosome Location
|
Feature . Primary Identifier |
Start | End | Strand |
|---|---|---|---|
| WBGene00004076 | 1136785 | 1152705 | 1 |
4 Data Sets
| Name | URL |
|---|---|
| WormBaseAcedbConverter | |
| GO Annotation data set | |
| C. elegans genomic annotations (GFF3 Gene) | |
| Panther orthologue and paralogue predictions |
1 Downstream Intergenic Region
| WormBase ID | Name | Sequence Name | Length (nt) | Chromosome Location | Organism |
|---|---|---|---|---|---|
| intergenic_region_chrII_1152706..1163574 | 10869 | II: 1152706-1163574 | Caenorhabditis elegans |
183 Expression Clusters
| Regulated By Treatment | Description | Algorithm | Primary Identifier |
|---|---|---|---|
| Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons. | DESeq. False discovry rate (FDR) < 0.1. | WBPaper00048988:neuron_expressed | |
| Transcripts that showed significantly increased expression glp-1(e2141); TU3401 animals comparing to in TU3401 animals. | Fold change > 2, FDR < 0.01. | WBPaper00065993:glp-1(e2141)_upregulated | |
| Transcripts of coding genes that showed significantly decreased expression in muscle. | DESeq2 (version 1.24.0). Transcripts with a false-discovery rate adjusted p-value less than 0.05 were considered significantly differentially expressed. | WBPaper00062325:muscle_depleted_coding-RNA | |
| mRNAs that showed decreased expression in 1 cell mebryo comparing to in oocyte, according to RNAseq analysis. | Gaussian error propagation. As cutoff for the up-regulated genes authors used log2 fold change > 1 and P < 0.05 and as cutoff for the down-regulated genes authors used log2 fold change < -1 and P < 0.05. | WBPaper00045420:fertilization_downregulated_transcript | |
| Bacteria infection: Enterococcus faecalis | Genes with increased expression after 24 hours of infection by E.faecalis Fold changes shown are pathogen vs OP50. | For RNA-seq and tiling arrays, log2 fold changes between gene expression values of infected versus uninfected nematodes were calculated. For log2 fold changes > 0.00001 the values > 81.25th percentile were defined as up-regulated and for log2 fold changes < -0.00001 the values < 18.75th percentile were defined as down-regulated. | WBPaper00038438:E.faecalis_24hr_upregulated_TilingArray |
| Proteins detected in isolated mitochondria. | N.A. | WBPaper00067939:mitochondria_expressed_protein | |
| Genes that showed significantly increased expression in wrn-1(gk99) comparing to in N2, according to RNAseq. | DESeq was used to calculate the fold changes, log fold changes, and significance of the changes for each comparison. | WBPaper00045934:wrn-1(gk99)_upregulated | |
| Transcripts expressed in the epithelial tissues surrounding the pharynx that includes the arcade and intestinal valve (AIV) cells, according to PAT-Seq analysis using Pbath-15-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:arcade_intestinal-valve_expressed | |
| Transcripts expressed in body muscle, according to PAT-Seq analysis using Pmyo-3-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:body-muscle_expressed | |
| Transcripts expressed in GABAergic neuron, according to PAT-Seq analysis using Punc-47-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:GABAergic-neuron_expressed | |
| Proteins interacting with NHR-49-GFP according to co-IP and LC-MS. | N.A. | WBPaper00064071:NHR-49_interacting | |
| Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:hypodermis_expressed | |
| Transcripts that showed significantly decreased expression in atfs-1(cmh15) (null allele) animals comparing to in N2 animals at L4 larva stage. | edgeR, fold change > 2, FDR < 0.05 | WBPaper00060909:atfs-1(cmh15)_downregulated | |
| Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:intestine_expressed | |
| Transcripts expressed in NMDA neuron, according to PAT-Seq analysis using Pnmr-1-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:NMDA-neuron_expressed | |
| Transcripts expressed in pharynx, according to PAT-Seq analysis using Pmyo-2-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:pharynx_expressed | |
| Transcripts expressed in seam cells, according to PAT-Seq analysis using Pgrd-10-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:seam_expressed | |
| Genes with expression level regulated by genotype (N2 vs CB4856) at Late reproduction stage (96 hours at 24 centigrade). | Authors permuted transcript values and used a genome-wide threshold of log10 P-value = 2, which resembles a false discovery rate (FDR) of 0.0118. | WBPaper00040858:eQTL_regulated_reproductive | |
| Transcripts that showed significantly increased expression in day 1 adult hermaphrodite comparing to in L4 larva glp-1(e2141) animals. | Fold change > 2, FDR < 0.05 | WBPaper00064088:Day-1-adult_vs_L4_upregulated_glp-1(e2141) | |
| Bacteria infection: Bacillus thuringiensis | mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 10 mix) vs BT407 12h), according to RNAseq. | Cuffdiff, ajusted p-value < 0.01. | WBPaper00046497:B.thuringiensis_0.1mix_downregulated_12h |
| Bacteria infection: Bacillus thuringiensis | mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 2 mix) vs BT407 6h), according to RNAseq. | Cuffdiff, ajusted p-value < 0.01. | WBPaper00046497:B.thuringiensis_0.5mix_downregulated_6h |
| Transcripts that showed significantly increased expression in sin-3(tm1276) comparing to in N2. | DESeq2, fold change > 2, p-value < 0.01. | WBPaper00061203:sin-3(tm1276)_upregulated | |
| Bacteria infection: Bacillus thuringiensis | mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 2 mix) vs BT407 12h), according to RNAseq. | Cuffdiff, ajusted p-value < 0.01. | WBPaper00046497:B.thuringiensis_0.5mix_downregulated_12h |
| Transcripts detected in germline isolated from day-1 adult hermaphrodite animals. | All three experiments have CPM >= 1. | WBPaper00067147:germline_expressed | |
| Proteins interacting with GST-FBXA-210(C-terminal) via IP-MS in young adult animals. Proteins shown here are enriched in GST | Fold change > 2 and p-value < 0.1 were defined as threshold for significance. | WBPaper00068277:FBXA-210(C-terminal)_interacting_YoungAdult | |
| Bacteria diet: Comamonas aquatica DA1887 vs. E. coli OP50 | Transcripts that showed significantly decreased expression in N2 L3 larva animals fed with Comamonas aquatica strain DA1887, comparing to in N2 L3 larva animals fed with E. coli OP50. | edgeR, fold change > 2, p-value < 0.05. | WBPaper00067248:C.aquatica_downregulated_L3 |
| Transcripts that showed significantly increased expression in aak-1(tm1944);aak-2(ok524) animals comparing to in N2. | DEseq 1.18.0, adjusted p-value < 0.05. | WBPaper00056471:aak-1(tm1944);aak-2(ok524)_upregulated | |
| Transcripts that showed significantly increased expression in nhr-114(gk849) comparing to wild type animals at L4 larva. | DESeq2 1.26.0, fold change > 2, FDR < 0.05. | WBPaper00064539:nhr-114(gk849)_upregulated | |
| Heat Shock: 35C 4 hours at L4 larva stage. | Transcripts that showed significantly decreased expression after L4 larva N2 animals were heat stressed at 35C for 4 hours | DESeq2 | WBPaper00057154:HeatShock_downregulated_mRNA |
| Transcripts that showed significantly decreased expression in sin-3(tm1276) comparing to in N2 at early embryo when there were only 3 -5 eggs in the adult. | DESeq2, fold change > 2, adjusted p-value < 0.01 | WBPaper00058598:sin-3(tm1276)_downregulated |
10 Expression Patterns
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| Expr1031965 | Tiling arrays expression graphs | |||
| Also expressed in (comments from author) : high intensity GFPMosaic population. Strain: BC13916 | [W09B6.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTGAAGACAAAAAGAATGGTCTCA] 3' and primer B 5' [TGAATGCCCGTCCAAGAT] 3'. | Expr6859 | Adult Expression: intestine; Reproductive System; gonad sheath cells; hypodermis; seam cells; Larval Expression: intestine; Reproductive System; developing vulva; hypodermis; seam cells; | |
| Expr15196 | GFP::POD-2 expression is strongest in the intestine, and prominent in the hypodermis, gonad sheath (especially proximal sheath), CAN neuron, and excretory duct. No germline expression was detected,including by anti-GFP staining of dissected gonads. This was most clearly observed by examination of the distal gonad; however, abundant GFP::POD-2 or FASN-1::GFP expression in the proximal sheath cells made it more difficult to evaluate expression in the proximal germline. GFP::POD-2 expression in embryos first appears with development of hypodermal and intestinal cells. Neither GFP::POD-2 nor GFP-labelled FASN-1 is expressed in the DTC. | |||
| Reporter gene fusion type not specified. | Expr9289 | pod-2 is expressed in the hypodermis and intestine. | ||
| Expr12921 | A transcriptional reporter line expressing the pod-2 promoter driving GFP showed intestinal GFP expression. | |||
| Expr1021344 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 | |||
| Expr1158544 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015 | |||
| Expr2014988 | Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans). | |||
| Expr2033223 | Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans). | |||
| Original chronogram file: chronogram.2327.xml | [W09B6.1:gfp] transcriptional fusion. | Chronogram1203 |
24 GO Annotation
| Annotation Extension | Qualifier |
|---|---|
| located_in | |
| located_in | |
| involved_in | |
| enables | |
| enables | |
| enables | |
| enables | |
| enables | |
| involved_in | |
| enables | |
| enables | |
| enables | |
| enables | |
| enables | |
| enables | |
| enables | |
| involved_in | |
| involved_in | |
| involved_in | |
| involved_in | |
| involved_in | |
| involved_in | |
| involved_in | |
| involved_in |
9 Homologues
| Type |
|---|
| least diverged orthologue |
| least diverged orthologue |
| least diverged orthologue |
| least diverged orthologue |
| least diverged orthologue |
| least diverged orthologue |
| least diverged orthologue |
| orthologue |
| least diverged orthologue |
24 Ontology Annotations
| Annotation Extension | Qualifier |
|---|---|
| located_in | |
| located_in | |
| involved_in | |
| enables | |
| enables | |
| enables | |
| enables | |
| enables | |
| involved_in | |
| enables | |
| enables | |
| enables | |
| enables | |
| enables | |
| enables | |
| enables | |
| involved_in | |
| involved_in | |
| involved_in | |
| involved_in | |
| involved_in | |
| involved_in | |
| involved_in | |
| involved_in |
1 Regulates Expr Cluster
| Regulated By Treatment | Description | Algorithm | Primary Identifier |
|---|---|---|---|
| Proteins that showed more than 2-fold change of expression in pod-2(RNAi) comparing with control. | Protein spots that were differentially altered > 2-fold on average were selected. | WBPaper00038215:pod-2(RNAi)_regulated |
