Genomics
1 Transcripts
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:F45E4.2.1 | F45E4.2.1 |
973
 |
IV: 7633360-7634653 |
Other
1 CDSs
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| CDS:F45E4.2 | F45E4.2 |
681
|
IV: 7633430-7633567 |
41 RNAi Result
21 Allele
| Public Name |
|---|
| gk964278 |
| gk964500 |
| gk963722 |
| gk963417 |
| gk963416 |
| h12783 |
| WBVar01688000 |
| WBVar01581643 |
| WBVar01581642 |
| gk622765 |
| gk523317 |
| gk862723 |
| gk734886 |
| gk205841 |
| gk205842 |
| gk336038 |
| gk205839 |
| gk445467 |
| gk205840 |
| WBVar00190770 |
| ok2155 |
1 Chromosome Location
|
Feature . Primary Identifier |
Start | End | Strand |
|---|---|---|---|
| WBGene00004046 | 7633360 | 7634653 | 1 |
4 Data Sets
| Name | URL |
|---|---|
| WormBaseAcedbConverter | |
| GO Annotation data set | |
| C. elegans genomic annotations (GFF3 Gene) | |
| Panther orthologue and paralogue predictions |
1 Downstream Intergenic Region
| WormBase ID | Name | Sequence Name | Length (nt) | Chromosome Location | Organism |
|---|---|---|---|---|---|
| intergenic_region_chrIV_7634654..7634785 | 132 | IV: 7634654-7634785 | Caenorhabditis elegans |
174 Expression Clusters
| Regulated By Treatment | Description | Algorithm | Primary Identifier |
|---|---|---|---|
| oocyte proteins identified by two or more unique peptides during proteomics study. | In the pooled data set, 1453 C. elegans proteins were identified with a probability >= 0.9 according to ProteinProphet, of which 1165 proteins were identified by more than one unique peptide. | WBPaper00038289:oocyte_protein | |
| Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons. | DESeq. False discovry rate (FDR) < 0.1. | WBPaper00048988:neuron_expressed | |
| adult vs dauer larva | Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C. | N.A. | WBPaper00050488:adult_vs_dauer_regulated_N2_20C |
| Transcripts enriched in ASG according to single cell RNAseq. | Genes that pass the Bonferroni threshold for multiple comparisons (q < 0.05) are significantly enriched. | WBPaper00061651:ASG_enriched | |
| Osmotic stress | Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when food was present | DESeq(version 1.10.1), FDR < 0.05. | WBPaper00050726:OsmoticStress_regulated_Food |
| Osmotic stress | Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when no food was present | DESeq(version 1.10.1), FDR < 0.05. | WBPaper00050726:OsmoticStress_regulated_NoFood |
| Transcripts that showed significantly increased expression after animals were treated with 50uM Rifampicin and 250uM Allantoin from day 1 to day 3 adult hermaphradite. | DESeq2(v1.14.1), fold change > 2, p-value < 0.05 | WBPaper00055354:Rifampicin-Allantoin_upregulated | |
| Transcripts that showed significantly higher expression in somatic gonad precursor cells (SGP) vs. head mesodermal cells (hmc). | DESeq2, fold change >= 2, FDR <= 0.01. | WBPaper00056826:SGP_biased | |
| Transcripts expressed in the epithelial tissues surrounding the pharynx that includes the arcade and intestinal valve (AIV) cells, according to PAT-Seq analysis using Pbath-15-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:arcade_intestinal-valve_expressed | |
| Genes significantly enriched in NSM neurons (isolated by FACS) versus the reference, according to RNAseq analysis towards total RNA. | Gene expression quantification and differential expression was analyzed using cufflinks v2.2.1. Enriched contains only genes significantly enriched (differentially expressed >= 2.4 fold in total RNA or >= 3.2 fold in DSN treated total RNA) in the NSM neurons versus the reference. | WBPaper00045974:NSM_enriched_totalRNA_RNAseq | |
| Transcripts expressed in body muscle, according to PAT-Seq analysis using Pmyo-3-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:body-muscle_expressed | |
| Transcripts expressed in GABAergic neuron, according to PAT-Seq analysis using Punc-47-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:GABAergic-neuron_expressed | |
| Proteins interacting with NHR-49-GFP according to co-IP and LC-MS. | N.A. | WBPaper00064071:NHR-49_interacting | |
| Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:hypodermis_expressed | |
| Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:intestine_expressed | |
| Transcripts expressed in NMDA neuron, according to PAT-Seq analysis using Pnmr-1-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:NMDA-neuron_expressed | |
| Transcripts expressed in pharynx, according to PAT-Seq analysis using Pmyo-2-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:pharynx_expressed | |
| Transcripts expressed in seam cells, according to PAT-Seq analysis using Pgrd-10-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:seam_expressed | |
| Transcripts detected in germline isolated from day-1 adult hermaphrodite animals. | All three experiments have CPM >= 1. | WBPaper00067147:germline_expressed | |
| Proteins interacting with GST-FBXA-210(C-terminal) via IP-MS in young adult animals. Proteins shown here are enriched in GST | Fold change > 2 and p-value < 0.1 were defined as threshold for significance. | WBPaper00068277:FBXA-210(C-terminal)_interacting_YoungAdult | |
| Transcripts that showed significantly changed expression in 6-day post-L4 adult hermaphrodite comparing to in 1-day post L4 adult hermaphrodite animals. | Sleuth | WBPaper00051558:aging_regulated | |
| Transcripts that showed significantly decreased expression in daf-16(mgDf50) comparing to in N2 at L1 larva stage. | DESeq v1.20.0 was used to analyze differential gene expression. Transcripts with adjusted p-value < 0.05 were considered differentialled expressed. | WBPaper00048971:daf-16(mgDf50)_downregulated_L1 | |
| Transcripts detected in body muscle nuclei according to a nuclear FACS-based strategy. | Cufflinks | WBPaper00065120:body-muscle-transcriptome | |
| Transcripts that showed significantly increased expression in clk-1(qm30) comparing to in N2. | Differential gene expression analysis was performed using the quasi-likeli-hood framework in edgeR package v. 3.20.1 in R v. 3.4.1. | WBPaper00053810:clk-1(qm30)_upregulated | |
| Transcripts that showed significantly increased expression in isp-1(qm150) comparing to in N2. | Differential gene expression analysis was performed using the quasi-likeli-hood framework in edgeR package v. 3.20.1 in R v. 3.4.1. | WBPaper00053810:isp-1(qm150)_upregulated | |
| Transcripts that showed significantly increased expression in nuo-6(qm200) comparing to in N2. | Differential gene expression analysis was performed using the quasi-likeli-hood framework in edgeR package v. 3.20.1 in R v. 3.4.1. | WBPaper00053810:nuo-6(qm200)_upregulated | |
| Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference). | A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. | WBPaper00037950:coelomocytes_L2-larva_expressed | |
| Genes that showed expression levels higher than the corresponding reference sample (L3/L4 all cell reference). | A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. | WBPaper00037950:dopaminergic-neurons_L3-L4-larva_expressed | |
| Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference). | A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. | WBPaper00037950:excretory-cell_L2-larva_expressed | |
| Transcripts that showed significantly altered expression at URX, AQR, and PQR neurons in camt-1(ok515) animals comparing to in wild type AX1888-1 strain. | RNA-seq data were mapped using PRAGUI - a Python 3-based pipeline for RNA-seq data analysis. | WBPaper00061902:camt-1(ok515)_regulated_URX-AQR-PQR |
15 Expression Patterns
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| Expr1031946 | Tiling arrays expression graphs | |||
| Strain: BC14272 | [plp-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TCTCCACTTCACCTCACTCAGA] 3' and primer B 5' [ACACTTCCGTCCGAGATCC] 3'. | Expr6078 | Adult Expression: intestine; Reproductive System; vulva other; body wall muscle; Nervous System; ventral nerve cord; head neurons; tail neurons; Larval Expression: intestine; body wall muscle; Nervous System; ventral nerve cord; head neurons; tail neurons; | |
| Expr15797 | PLP-1 localizes to P granules throughout the germ line andto similar perinuclear granules in some somatic cells. PLP-1 was present throughout the germ line, with prominent concentration on granules arranged in what appeared as perinuclear circles. Distribution of PLP-1 in the core cytoplasm was more readily noticeable in unfixed, live germ lines expressing the plp-1::gfp transgene. Similar distribution patterns were observed in both hermaphrodite and male germ lines. In worms expressing the plp-1::gfp transgene, we noticed GFP fluorescence in several cells surrounding the pharyngeal bulbs and in cells in the tail region. Even in these somatic cells, PLP-1::GFP was concentrated on perinuclear granules, in addition to being present in the cytoplasm. | |||
| Expr15798 | PLP-1 localizes to P granules throughout the germ line andto similar perinuclear granules in some somatic cells. PLP-1 was present throughout the germ line, with prominent concentration on granules arranged in what appeared as perinuclear circles. Distribution of PLP-1 in the core cytoplasm was more readily noticeable in unfixed, live germ lines expressing the plp-1::gfp transgene. Similar distribution patterns were observed in both hermaphrodite and male germ lines. In worms expressing the plp-1::gfp transgene, we noticed GFP fluorescence in several cells surrounding the pharyngeal bulbs and in cells in the tail region. Even in these somatic cells, PLP-1::GFP was concentrated on perinuclear granules, in addition to being present in the cytoplasm. | |||
| Picture: Fig. 5. The same pattern was seen with two separate antibodies raised against distinct PLP-1 peptides, and both nuclear and P granule expression was largely eliminated in plp-1 (RNAi) embryos, confirming their specificity. | Expr8706 | Immunoreactive PLP-1 localizes to the nuclei of all blastomeres beginning by the two-cell stage of embryogenesis, implying that PLP-1 is a maternally encoded transcription factor. It is also present in the germline-specific P granules of early embryos. | PLP-1 is transiently asymmetrically localized during telophase of the dividing EMS cell (observed in 12 embryos at the correct stage), with higher levels of the protein in the chromatin of the future E cell nucleus and low or undetectable levels in that of MS. A similar transient asymmetry in PLP-1 levels was observed at many divisions throughout early development, starting at cleavage of the zygote, with higher levels seen in the cytoplasm and forming nucleus of the posterior daughter, P1 (observed in 5 embryos). The anteroposterior asymmetry in PLP-1 was also observed in the AB lineage during the division of the AB granddaughters (observed in 7 embryos): for example, PLP-1 is higher in the chromatin of the posterior daughter ABalp than that of its anterior sister ABala. In all cases, the asymmetry was observed only during telophase and at the time that nuclei were reassembling after cell division; the staining was symmetric at all other times. PLP-1 was always seen at higher levels in the forming nuclei of the posterior daughters. | |
| Expr1151249 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015 | |||
| Expr15799 | Both the plp-1::gfp transgene and anti-PLP-1 antibodies revealed the presence of PLP-1 in the cytoplasm of both somatic and germline blastomeres throughout embryonic development. | |||
| Expr15800 | Both the plp-1::gfp transgene and anti-PLP-1 antibodies revealed the presence of PLP-1 in the cytoplasm of both somatic and germline blastomeres throughout embryonic development. | |||
| Expr3786 | PLP-1 was expressed in oocytes and embryos. | PLP-1 was expressed in oocytes and embryos. Unexpectedly, it was localized to the cytoplasm, not the nuclei, of embryos. Although it is possible that the GFP-linked reporter protein did not behave like the endogenous protein, it is not likely the case because, later in development, different localization of the reporter protein was observed: in late larval and adult stages, PLP-1 was found near the nuclear envelope. | ||
| Expr2040198 | Translational efficiency and RNA abundance/Ribosome occupancy across early embryonic stages (1-cell to 8-cell). For each developmental stage, translational efficiency was calculated as the ratio between ribosome footprint reads and mRNA abundance after normalization. A detailed description of the experimental methods and analysis can be found in: Shukla Y, Ghatpande V, Hu CF, Dickinson DJ, Cenik C. Landscape and regulation of mRNA translation in the early C. elegans embryo. Cell Rep. 2025 June 24;44(6):115778. doi: 10.1016/j.celrep.2025.115778. PMID: 40450690 | |||
| Expr1024885 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 | |||
| Expr2014962 | Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans). | |||
| Expr15801 | In contrast to Witze et al., 2009, which found PLP-1 mostly in the nuclei of embryos, we did not observe any detectable nuclear localization of PLP-1 in the transgenic reporter lines described above or in germ lines and embryos immunostained with PLP-1-specific antibodies. We think differences in antibody specificities and immunostaining conditions are the probable causes of the variation between our observations and those previously published. | |||
| Expr15802 | In contrast to Witze et al., 2009, which found PLP-1 mostly in the nuclei of embryos, we did not observe any detectable nuclear localization of PLP-1 in the transgenic reporter lines described above or in germ lines and embryos immunostained with PLP-1-specific antibodies. We think differences in antibody specificities and immunostaining conditions are the probable causes of the variation between our observations and those previously published. | |||
| Expr2033197 | Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans). |
19 GO Annotation
| Annotation Extension | Qualifier |
|---|---|
| involved_in | |
| enables | |
| enables | |
| enables | |
| enables | |
| enables | |
| enables | |
| enables | |
| located_in | |
| located_in | |
| located_in | |
| located_in | |
| located_in | |
| located_in | |
| involved_in | |
| involved_in | |
| located_in | |
| enables | |
| enables |
14 Homologues
| Type |
|---|
| orthologue |
| orthologue |
| orthologue |
| orthologue |
| orthologue |
| orthologue |
| orthologue |
| orthologue |
| least diverged orthologue |
| least diverged orthologue |
| least diverged orthologue |
| orthologue |
| least diverged orthologue |
| least diverged orthologue |
19 Ontology Annotations
| Annotation Extension | Qualifier |
|---|---|
| involved_in | |
| enables | |
| enables | |
| enables | |
| enables | |
| enables | |
| enables | |
| enables | |
| located_in | |
| located_in | |
| located_in | |
| located_in | |
| located_in | |
| located_in | |
| involved_in | |
| involved_in | |
| located_in | |
| enables | |
| enables |
2 Regulates Expr Cluster
| Regulated By Treatment | Description | Algorithm | Primary Identifier |
|---|---|---|---|
| Transcripts that showed significantly increased expression in plp-1(ok2155) adult animals comparing to in wild type. | DESeq2. Genes with at least 2-fold upregulation with a raw P value <= 0.05 only are listed. | WBPaper00060526:plp-1(ok2155)_upregulated | |
| Transcripts that showed significantly decreased expression in plp-1(ok2155) adult animals comparing to in wild type. | DESeq2. Genes with at least 2-fold upregulation with a raw P value <= 0.05 only are listed. | WBPaper00060526:plp-1(ok2155)_downregulated |
1 Upstream Intergenic Region
| WormBase ID | Name | Sequence Name | Length (nt) | Chromosome Location | Organism |
|---|---|---|---|---|---|
| intergenic_region_chrIV_7632549..7633359 | 811 | IV: 7632549-7633359 | Caenorhabditis elegans |
