Genomics
3 Transcripts
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:C29E6.1b.1 | C29E6.1b.1 |
2157
 |
IV: 11885613-11891082 |
| Transcript:C29E6.1a.1 | C29E6.1a.1 |
2631
|
IV: 11885615-11891081 |
| Transcript:C29E6.1c.1 | C29E6.1c.1 |
2082
|
IV: 11885618-11890892 |
Other
3 CDSs
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| CDS:C29E6.1b | C29E6.1b |
1962
|
IV: 11885618-11885678 |
| CDS:C29E6.1c | C29E6.1c |
2082
|
IV: 11885618-11885678 |
| CDS:C29E6.1a | C29E6.1a |
2439
|
IV: 11885618-11885678 |
89 Allele
| Public Name |
|---|
| gk964278 |
| gk964078 |
| gk964500 |
| gk962765 |
| gk962528 |
| s1733 |
| s2270 |
| s2377 |
| h16684 |
| gk676572 |
| gk213577 |
| gk366847 |
| gk627709 |
| gk213575 |
| gk538568 |
| gk213576 |
| gk768666 |
| gk213573 |
| gk816296 |
| gk213574 |
| gk430715 |
| gk213571 |
| gk665061 |
| gk213572 |
| gk521127 |
| gk882605 |
| gk837606 |
| gk432221 |
| gk594487 |
| gk730284 |
1 Chromosome Location
|
Feature . Primary Identifier |
Start | End | Strand |
|---|---|---|---|
| WBGene00002827 | 11885613 | 11891082 | 1 |
4 Data Sets
| Name | URL |
|---|---|
| WormBaseAcedbConverter | |
| GO Annotation data set | |
| C. elegans genomic annotations (GFF3 Gene) | |
| Panther orthologue and paralogue predictions |
1 Downstream Intergenic Region
| WormBase ID | Name | Sequence Name | Length (nt) | Chromosome Location | Organism |
|---|---|---|---|---|---|
| intergenic_region_chrIV_11891083..11899288 | 8206 | IV: 11891083-11899288 | Caenorhabditis elegans |
270 Expression Clusters
| Regulated By Treatment | Description | Algorithm | Primary Identifier |
|---|---|---|---|
| Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons. | DESeq. False discovry rate (FDR) < 0.1. | WBPaper00048988:neuron_expressed | |
| Transcripts of coding genes that showed significantly decreased expression in muscle. | DESeq2 (version 1.24.0). Transcripts with a false-discovery rate adjusted p-value less than 0.05 were considered significantly differentially expressed. | WBPaper00062325:muscle_depleted_coding-RNA | |
| Transcripts that showed significantly increased expression in ogt-1(ok1474) neuronal cells isolated by FACs comparing to in FACs isolated neuronal cells from wild type. | DESeq2, fold change > 2, FDR < 0.05. | WBPaper00066485:ogt-1(ok1474)_upregulated_neuron | |
| adult vs dauer larva | Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C. | N.A. | WBPaper00050488:adult_vs_dauer_regulated_N2_20C |
| Transcripts that showed significantly decreased expression in AGP22 [nhr-49(nr2041)I;glp-1(e2141)III] comparing to in CF1903 [glp-1(e2144)III] at Day 2 adults. | Fold change > 2, p Value of < 0.05 and a false discovery rate (FDR) of < 0.05. | WBPaper00061530:nhr-49(e2144)_downregulated | |
| Osmotic stress | Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when food was present | DESeq(version 1.10.1), FDR < 0.05. | WBPaper00050726:OsmoticStress_regulated_Food |
| Osmotic stress | Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when no food was present | DESeq(version 1.10.1), FDR < 0.05. | WBPaper00050726:OsmoticStress_regulated_NoFood |
| Transcripts that showed significantly increased expression after animals were treated with 50uM Rifampicin and 250uM Allantoin from day 1 to day 3 adult hermaphradite. | DESeq2(v1.14.1), fold change > 2, p-value < 0.05 | WBPaper00055354:Rifampicin-Allantoin_upregulated | |
| Transcripts that showed significantly increased expression after animals were treated with 50uM Rifampicin from day 1 to day 3 adult hermaphradite. | DESeq2(v1.14.1), fold change > 2, p-value < 0.05 | WBPaper00055354:Rifampicin_upregulated | |
| Transcripts that showed significantly increased expression after animals were treated with 100uM Psora and 250uM Allantoin from day 1 to day 3 adult hermaphradite. | DESeq2(v1.14.1), fold change > 2, p-value < 0.05 | WBPaper00055354:Psora-Allantoin_upregulated | |
| Transcripts that showed significantly increased expression after animals were treated with 100uM Rapamycin and 50mM Metformin from day 1 to day 3 adult hermaphradite. | DESeq2(v1.14.1), fold change > 2, p-value < 0.05 | WBPaper00055354:Rapamycin-Metformin_upregulated | |
| Transcripts that showed significantly increased expression in eft-2(RNAi) animals at N2 background. | DESeq2, fold change > 2 and p-value < 0.01. | WBPaper00067953:eft-2(RNAi)_upregulated_N2 | |
| Transcripts that showed significantly increased expression in eft-2(RNAi) animals at zip-2(tm4248) background. | DESeq2, fold change > 2 and p-value < 0.01. | WBPaper00067953:eft-2(RNAi)_upregulated_zip-2(tm4248) | |
| Transcripts that showed significantly increased expression in eif-2alpha(RNAi) animals at N2 background. | DESeq2, fold change > 2 and p-value < 0.01. | WBPaper00067953:eif-2alpha(RNAi)_upregulated_N2 | |
| Transcripts that showed significantly increased expression in eif-2alpha(RNAi) animals at zip-2(tm4248) background. | DESeq2, fold change > 2 and p-value < 0.01. | WBPaper00067953:eif-2alpha(RNAi)_upregulated_zip-2(tm4248) | |
| Genes that are significantly up regulated in tdp-1(ok803) poly(A) RNA-seq verses in N2. | DESeq v1.14, with cut-off p-value < 0.05 and FDR < 0.1. | WBPaper00046012:tdp-1(ok803)_upregulated | |
| Transcripts that showed significantly decreased expression in atfs-1(cmh15) (null allele) animals comparing to in N2 animals at L4 larva stage. | edgeR, fold change > 2, FDR < 0.05 | WBPaper00060909:atfs-1(cmh15)_downregulated | |
| Transcripts that showed significantly decreased expression in day 3 adult hermaphrodite comparing to in L4 larva daf-16(mu86);glp-1(e2141) animals. | Fold change > 2, FDR < 0.05 | WBPaper00064088:Day-3-adult_vs_L4_downregulated_daf-16(mu86);glp-1(e2141) | |
| Transcripts that showed significantly decreased expression in day 3 adult hermaphrodite comparing to in L4 larva glp-1(e2141) animals. | Fold change > 2, FDR < 0.05 | WBPaper00064088:Day-3-adult_vs_L4_downregulated_glp-1(e2141) | |
| Transcripts that showed significantly decreased expression in adbp-1(qj1) comparing to in N2 animals at L4 larva stage. | DESeq2, FDR < 0.05, fold change > 2. | WBPaper00067079:adbp-1(qj1)_downregulated_L4 | |
| Bacteria infection: Bacillus thuringiensis | mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 10 mix) vs BT407 6h), according to RNAseq. | Cuffdiff, ajusted p-value < 0.01. | WBPaper00046497:B.thuringiensis_0.1mix_downregulated_6h |
| Bacteria infection: Bacillus thuringiensis | mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 10 mix) vs BT407 12h), according to RNAseq. | Cuffdiff, ajusted p-value < 0.01. | WBPaper00046497:B.thuringiensis_0.1mix_downregulated_12h |
| Bacteria infection: Bacillus thuringiensis | mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 2 mix) vs BT407 6h), according to RNAseq. | Cuffdiff, ajusted p-value < 0.01. | WBPaper00046497:B.thuringiensis_0.5mix_downregulated_6h |
| Transcripts that showed significantly increased expression in sin-3(tm1276) comparing to in N2. | DESeq2, fold change > 2, p-value < 0.01. | WBPaper00061203:sin-3(tm1276)_upregulated | |
| Bacteria infection: Bacillus thuringiensis | mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 2 mix) vs BT407 12h), according to RNAseq. | Cuffdiff, ajusted p-value < 0.01. | WBPaper00046497:B.thuringiensis_0.5mix_downregulated_12h |
| Bacteria diet: Comamonas aquatica DA1887 vs. E. coli OP50 | Transcripts that showed significantly decreased expression in N2 L3 larva animals fed with Comamonas aquatica strain DA1887, comparing to in N2 L3 larva animals fed with E. coli OP50. | edgeR, fold change > 2, p-value < 0.05. | WBPaper00067248:C.aquatica_downregulated_L3 |
| Transcripts that showed significantly increased expression in hrde-1(tm1200) animals, comparing to in N2, after growing at 25C for five generations (late generation). | CuffDiff2 | WBPaper00051265:F4_hrde-1(tm1200)_upregulated | |
| Transcripts that showed significantly decreased expression in skn-1gf(lax188) comparing to in N2 animals at L4 stage fed with OP50 and exposed to PA14 for 4 hours. | DESeq2, FDR < 0.05, fold change > 2. | WBPaper00067255:skn-1(lax188)_downregulated_PA | |
| Transcripts that showed significantly increased expression in aak-1(tm1944);aak-2(ok524) animals comparing to in N2. | DEseq 1.18.0, adjusted p-value < 0.05. | WBPaper00056471:aak-1(tm1944);aak-2(ok524)_upregulated | |
| Transcripts that showed significantly increased expression in adr-1(tm668) and adr-1(gv6) comparing to in N2 at L4 larva stage. | DESeq FDR <= 0.05 | WBPaper00056617:adr-1_upregulated_L4_transcript |
10 Expression Patterns
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| Also expressed in (comments from author) : The listed expression pattern was from June 2004. When viewed again, May 2005, there was only hypodermis in adults. Strain: BC10642 | [let-653::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AAGTAGGTGGAGCGAAGCAA] 3' and primer B 5' [TTAGTGGATGTCGGATTTACTGAA] 3'. | Expr5376 | Adult Expression: intestine; Reproductive System; vulva other; body wall muscle; hypodermis; seam cells; Larval Expression: intestine; rectal epithelium; Reproductive System; developing vulva; body wall muscle; hypodermis; seam cells; Nervous System; head neurons; | |
| Expr1031364 | Tiling arrays expression graphs | |||
| Expr13008 | A let-653 promoter::GFP transcriptional reporter was expressed in external (cuticle-producing) epithelial cells, including the epidermis, vulva, rectum and excretory duct and pore, but was mostly excluded from internal epithelia such as the pharynx, intestine and excretory canal cell. Occasionally, let-653pro::GFP expression was observed in the canal cells of embryos, but this expression disappeared in later stages LET-653 fusion proteins were never observed in the canal cell. | |||
| Expr13009 | In the vulva and likely in the excretory duct and pore tubes, LET-653 localizes transiently to two distinct pre-cuticular apical extracellular matrix compartments. | |||
| Original chronogram file: chronogram.1525.xml | [C29E6.1:gfp] transcriptional fusion. | Chronogram509 | ||
| Expr15950 | LET-653 is expressed by all vulva cell types. The ZP proteins FBN-1 and LET-653 showed somewhat complementary luminal patterns. Beginning at L4.2, and as previously reported for LET-653(PAN domain) fragments (Gill et al., 2016), LET-653 decorated a core structure in the center of the lumen that rises to the level of the vulD and vulE cells, along with lateral elements that connect this core to the vulA, vulB1 and vulB2 cells and to the surrounding epidermis. The central core structure could also be detected very weakly by DIC. This core changed appearance during vulva eversion, but remained visible in the most ventral, 2 ̊-cell-derived region through the L4.9 stage. Transiently, at the L4.3-L4.5 stages, LET-653 also weakly marked the apical membranes of most cells. Finally, FBN-1 overlapped with LET-653-marked structures near vulB1 and vulB2 surfaces, but otherwise was mainly excluded from the core area and instead filled the more dorsal part of the lumen above the core. During vulva eversion, FBN-1 became excluded from the dorsal-most portions of the lumen lined by 1 ̊-derived cells, such that LET-653 and FBN-1 together appeared to demarcate at least three separate luminal zones roughly corresponding to the regions outlined by the vulA/B cells, vulC/D cells, and vulE/F cells. | |||
| Expr2013069 | Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans). | |||
| Expr2031301 | Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans). | |||
| Expr1016864 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 | |||
| Expr1145484 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015 |
21 GO Annotation
| Annotation Extension | Qualifier |
|---|---|
| involved_in | |
| enables | |
| involved_in | |
| involved_in | |
| involved_in | |
| involved_in | |
| involved_in | |
| involved_in | |
| results_in_morphogenesis_of(WBbt:0007832) | involved_in |
| involved_in | |
| located_in | |
| located_in | |
| located_in | |
| located_in | |
| located_in | |
| located_in | |
| involved_in | |
| involved_in | |
| located_in | |
| located_in | |
| located_in |
8 Homologues
| Type |
|---|
| orthologue |
| orthologue |
| orthologue |
| orthologue |
| orthologue |
| orthologue |
| orthologue |
| orthologue |
21 Ontology Annotations
| Annotation Extension | Qualifier |
|---|---|
| involved_in | |
| enables | |
| involved_in | |
| involved_in | |
| involved_in | |
| involved_in | |
| involved_in | |
| involved_in | |
| results_in_morphogenesis_of(WBbt:0007832) | involved_in |
| involved_in | |
| located_in | |
| located_in | |
| located_in | |
| located_in | |
| located_in | |
| located_in | |
| involved_in | |
| involved_in | |
| located_in | |
| located_in | |
| located_in |
1 Upstream Intergenic Region
| WormBase ID | Name | Sequence Name | Length (nt) | Chromosome Location | Organism |
|---|---|---|---|---|---|
| intergenic_region_chrIV_11884135..11885612 | 1478 | IV: 11884135-11885612 | Caenorhabditis elegans |
