Genomics
1 Transcripts
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:F25F2.2.1 | F25F2.2.1 |
13422
 |
III: 4520357-4536994 |
Other
1 CDSs
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| CDS:F25F2.2 | F25F2.2 |
12987
|
III: 4520459-4520695 |
242 Allele
| Public Name |
|---|
| otn11048 |
| otn11049 |
| otn11050 |
| otn11051 |
| otn9735 |
| otn9736 |
| otn9737 |
| otn9738 |
| otn9739 |
| otn9740 |
| otn9741 |
| gk312566 |
| WBVar01445325 |
| gk778596 |
| otn13065 |
| otn13067 |
| otn13066 |
| otn13068 |
| WBVar01263094 |
| WBVar01263096 |
| WBVar01263097 |
| WBVar01263091 |
| WBVar01263092 |
| WBVar01263093 |
| otn2943 |
| otn2942 |
| gk917477 |
| gk419989 |
| gk419990 |
| gk588013 |
1 Chromosome Location
|
Feature . Primary Identifier |
Start | End | Strand |
|---|---|---|---|
| WBGene00000396 | 4520357 | 4536994 | 1 |
4 Data Sets
| Name | URL |
|---|---|
| WormBaseAcedbConverter | |
| GO Annotation data set | |
| C. elegans genomic annotations (GFF3 Gene) | |
| Panther orthologue and paralogue predictions |
1 Downstream Intergenic Region
| WormBase ID | Name | Sequence Name | Length (nt) | Chromosome Location | Organism |
|---|---|---|---|---|---|
| intergenic_region_chrIII_4536995..4537280 | 286 | III: 4536995-4537280 | Caenorhabditis elegans |
219 Expression Clusters
| Regulated By Treatment | Description | Algorithm | Primary Identifier |
|---|---|---|---|
| oocyte proteins identified by two or more unique peptides during proteomics study. | In the pooled data set, 1453 C. elegans proteins were identified with a probability >= 0.9 according to ProteinProphet, of which 1165 proteins were identified by more than one unique peptide. | WBPaper00038289:oocyte_protein | |
| Genes with expression altered >= 3-fold in dpy-10(e128) mutants. | Data across the wild type series was analyzed using the Significance analysis of Microarrays (SAM) algorithm (to calculate the False Discovery Rate (FDR)). | WBPaper00035873:dpy-10_regulated | |
| Transcripts that showed significantly increased expression in L1 neural cells comparing to in adult neural cells. | DESeq2 (v1.18.1) fold change > 2, P-adj<0.05, using BenjaminiHochberg correction. | WBPaper00060811:L1_vs_adult_upregulated_neural | |
| Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons. | DESeq. False discovry rate (FDR) < 0.1. | WBPaper00048988:neuron_expressed | |
| Transcripts of coding genes that showed significantly decreased expression in muscle. | DESeq2 (version 1.24.0). Transcripts with a false-discovery rate adjusted p-value less than 0.05 were considered significantly differentially expressed. | WBPaper00062325:muscle_depleted_coding-RNA | |
| Osmotic stress | Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when food was present | DESeq(version 1.10.1), FDR < 0.05. | WBPaper00050726:OsmoticStress_regulated_Food |
| Neuronally enriched transcripts according to a comparison of neuronal nuclei IP samples to total nuclei using isolation of nuclei from tagged specific cell types (INTACT) technology. | DESEQ2, fold change > 2 and FDR < 0.01. | WBPaper00062103:neuron_enriched | |
| Transcripts that showed significantly increased expression after animals were treated with 50uM Rifampicin from day 1 to day 3 adult hermaphradite. | DESeq2(v1.14.1), fold change > 2, p-value < 0.05 | WBPaper00055354:Rifampicin_upregulated | |
| Transcripts that showed significantly increased expression after animals were treated with 100uM Psora and 250uM Allantoin from day 1 to day 3 adult hermaphradite. | DESeq2(v1.14.1), fold change > 2, p-value < 0.05 | WBPaper00055354:Psora-Allantoin_upregulated | |
| Transcripts that showed significantly increased expression after animals were treated with 100uM Rapamycin and 50mM Metformin from day 1 to day 3 adult hermaphradite. | DESeq2(v1.14.1), fold change > 2, p-value < 0.05 | WBPaper00055354:Rapamycin-Metformin_upregulated | |
| Transcripts expressed in the epithelial tissues surrounding the pharynx that includes the arcade and intestinal valve (AIV) cells, according to PAT-Seq analysis using Pbath-15-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:arcade_intestinal-valve_expressed | |
| Transcripts expressed in body muscle, according to PAT-Seq analysis using Pmyo-3-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:body-muscle_expressed | |
| Transcripts expressed in GABAergic neuron, according to PAT-Seq analysis using Punc-47-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:GABAergic-neuron_expressed | |
| Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:hypodermis_expressed | |
| Transcripts that showed significantly decreased expression in day 3 adult hermaphrodite comparing to in L4 larva glp-1(e2141) animals. | Fold change > 2, FDR < 0.05 | WBPaper00064088:Day-3-adult_vs_L4_downregulated_glp-1(e2141) | |
| Bacteria infection: Bacillus thuringiensis | mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 10 mix) vs BT407 12h), according to RNAseq. | Cuffdiff, ajusted p-value < 0.01. | WBPaper00046497:B.thuringiensis_0.1mix_downregulated_12h |
| Bacteria infection: Bacillus thuringiensis | mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 2 mix) vs BT407 12h), according to RNAseq. | Cuffdiff, ajusted p-value < 0.01. | WBPaper00046497:B.thuringiensis_0.5mix_downregulated_12h |
| Transcripts detected in germline isolated from day-1 adult hermaphrodite animals. | All three experiments have CPM >= 1. | WBPaper00067147:germline_expressed | |
| Transcripts that showed significantly increased expression in mrg-1(qa6200) comparing to in control animals in primordial germ cells (PGCs) at L1 larva stage. | DESeq2(v1.32.0), FDR < 0.05. | WBPaper00064315:mrg-1(qa6200)_upregulated_PGCs | |
| Transcripts that showed significantly increased expression in hrde-1(tm1200) animals, comparing to in N2, after growing at 25C for five generations (late generation). | CuffDiff2 | WBPaper00051265:F4_hrde-1(tm1200)_upregulated | |
| Transcripts that showed significantly decreased expression in skn-1gf(lax188) comparing to in N2 animals at L4 stage fed with OP50 and exposed to PA14 for 4 hours. | DESeq2, FDR < 0.05, fold change > 2. | WBPaper00067255:skn-1(lax188)_downregulated_PA | |
| Transcripts that showed significantly increased expression in aak-1(tm1944);aak-2(ok524) animals comparing to in N2. | DEseq 1.18.0, adjusted p-value < 0.05. | WBPaper00056471:aak-1(tm1944);aak-2(ok524)_upregulated | |
| Transcripts that showed significantly increased expression in animals exposed to 400uM tamoxifen from L1 to L4 larva stage. | DEseq2, fold change > 2 | WBPaper00064505:tamoxifen_upregulated | |
| Transcripts that showed significantly increased expression in alg-1(gk214), comparing to in N2. | DESeq2, Fold change > 1.5. | WBPaper00051404:alg-1(gk214)_upregulated | |
| Transcripts that showed significantly changed expression in 6-day post-L4 adult hermaphrodite comparing to in 1-day post L4 adult hermaphrodite animals. | Sleuth | WBPaper00051558:aging_regulated | |
| Bacteria infection: Staphylococcus aureus | Transcripts that showed significantly decreased expression in animals experimentally colonised by a wild microbiota community and infected by the widespread animal pathogen, Staphylococcus aureus, comparing to animals not colonized by microbiota and not infected by pathogen. | DeSeq2 (v. 1.42.0), Wald analyses testing against a null hypothesis of < |1.5|-fold change in gene expression between treatments (BenjaminiHochberg adjusted false detection rate of p <= 0.05. | WBPaper00067479:Microbiota-Pathogen_vs_control_downregulated |
| Bacteria infection: Staphylococcus aureus | Transcripts that showed significantly decreased expression in animals experimentally colonised by a wild microbiota community and infected by the widespread animal pathogen, Staphylococcus aureus, comparing to animals colonized by microbiota but not infected by pathogen. | DeSeq2 (v. 1.42.0), Wald analyses testing against a null hypothesis of < |1.5|-fold change in gene expression between treatments (BenjaminiHochberg adjusted false detection rate of p <= 0.05. | WBPaper00067479:Microbiota-Pathogen_vs_Microbiota_downregulated |
| Significantly differentially expressed genes as determined by microarray analysis of wild-type and cde-1 mutant germlines. | RNAs that changed at least 2-fold with a probability of p < 0.05 were considered differentially regulated between wildtype and cde-1. | WBPaper00035269:cde-1_regulated | |
| Transcripts that showed significantly increased expression after exposure to 75uM paraquat(PQ) from L1 to day 2 adult stage in skn-1(lax188) animals | fold change > 2 | WBPaper00058711:paraquat_upregulated | |
| Transcripts that showed significantly increased expression in 10-days post L4 adult hermaphrodite N2 grown at 20C, comparing to in 1-day post L4 adult hermaphrodite N2 animals grown at 20C. | CuffDiff, fold change > 2. | WBPaper00065096:Day10_vs_Day1_upregulated |
12 Expression Patterns
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| Expr2009802 | Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans). | |||
| Also expressed in (comments from author) : No comments. Strain: BC16095 | [cdh-4::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTGTTTTCTGAATCTACTTTGAGG] 3' and primer B 5' [ACCCGATGTTTCTTGATTATTTTT] 3'. | Expr5857 | Adult Expression: pharynx; pharyngeal-intestinal valve; stomato-intestinal muscle; rectal epithelium; Reproductive System; distal tip cell; uterine muscle; vulval muscle; vulva other; excretory cell; Nervous System; head neurons; Larval Expression: pharynx; pharyngeal-intestinal valve; stomato-intestinal muscle; rectal epithelium; Reproductive System; distal tip cell; developing vulva; excretory cell; Nervous System; head neurons; | |
| Expr1030217 | Tiling arrays expression graphs | |||
| Picture: Figure 6. | Expr8044 | Strong expression could be observed in the embryo already before elongation and continuing throughout development. The number of GFP positive cells increases between the end of gastrulation and the 2-fold stage when a large number of cells in the head including neurons, hypodermal cells and the pharyngeal primordium express GFP. Outside the head region expression is obvious in all embryonic motoneurons in the ventral cord and in rectal epithelial cells, gland cells and the anal depressor and intestinal muscle in the tail. The expression persisted through all larval stages, most prominently in pharyngeal muscle cells. In adult animals cdh-4::GFP was also expressed in the reproduction system namely the spermatheca, the vulva and uterine muscles and the distal tip cells (DTC). | ||
| Expr3896 | Expressed in intestinal muscles, vm1, pm8, head neurons, spermatheca and rectal epithelial cells. | |||
| Expr14864 | We also used smFISH to examine the expression of cdh-4 and cdh-3. Consistent with transgenic reporter studies (Sundararajan et al., 2014), we observed cdh-4 mRNA spots in the Q neuroblasts, as well as a wide range of other cells, including the neighboring seam and P cells, ventral nerve cord neurons and cells in the head region. In contrast, we found that during the initial polarization and migration phase, cdh-3 was specifically expressed in the Q neuroblasts, with additional expression only in a few unidentified cells in the head. Similar to unc-40, there was no significant difference in expression between QL and QR. Moreover, for both cdh-3 and cdh-4, the expression level correlated with migration distance (cdh-3 QL, Spearman r = 0.5765, p < 0.0001, QR, Spearman r = -0.4838, p < 0.0004; cdh-4 QL, Spearman r = 0.3176, p < 0.03, QR, Spearman r = -0.5070, p < 0.0004), indicating that expression increases during polarization and migration. | |||
| Expr10009 | As has been described, cdh-4 is broadly expressed, including in motorneurons, starting early in development (Schmitz et al., 2008). However, we found that by the L3 stage, the broad expression of Pcdh-4::gfp throughout the nervous system had ceased but expression continues, specifically in the GABAergic neurons. | |||
| Expr2028042 | Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans). | |||
| Original chronogram file: chronogram.1756.xml | [F25F2.2:gfp] transcriptional fusion. | Chronogram725 | ||
| Expr2040641 | Translational efficiency and RNA abundance/Ribosome occupancy across early embryonic stages (1-cell to 8-cell). For each developmental stage, translational efficiency was calculated as the ratio between ribosome footprint reads and mRNA abundance after normalization. A detailed description of the experimental methods and analysis can be found in: Shukla Y, Ghatpande V, Hu CF, Dickinson DJ, Cenik C. Landscape and regulation of mRNA translation in the early C. elegans embryo. Cell Rep. 2025 June 24;44(6):115778. doi: 10.1016/j.celrep.2025.115778. PMID: 40450690 | |||
| Expr1149434 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015 | |||
| Expr1017989 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |
16 GO Annotation
| Annotation Extension | Qualifier |
|---|---|
| located_in | |
| located_in | |
| located_in | |
| located_in | |
| enables | |
| involved_in | |
| enables | |
| enables | |
| involved_in | |
| located_in | |
| involved_in | |
| involved_in | |
| involved_in | |
| involved_in | |
| involved_in | |
| involved_in |
31 Homologues
| Type |
|---|
| orthologue |
| orthologue |
| orthologue |
| orthologue |
| orthologue |
| orthologue |
| orthologue |
| orthologue |
| orthologue |
| orthologue |
| orthologue |
| orthologue |
| orthologue |
| orthologue |
| orthologue |
| orthologue |
| orthologue |
| orthologue |
| orthologue |
| orthologue |
| orthologue |
| orthologue |
| orthologue |
| orthologue |
| orthologue |
| orthologue |
| orthologue |
| least diverged orthologue |
| orthologue |
| orthologue |
16 Ontology Annotations
| Annotation Extension | Qualifier |
|---|---|
| located_in | |
| located_in | |
| located_in | |
| located_in | |
| enables | |
| involved_in | |
| enables | |
| enables | |
| involved_in | |
| located_in | |
| involved_in | |
| involved_in | |
| involved_in | |
| involved_in | |
| involved_in | |
| involved_in |
1 Upstream Intergenic Region
| WormBase ID | Name | Sequence Name | Length (nt) | Chromosome Location | Organism |
|---|---|---|---|---|---|
| intergenic_region_chrIII_4518436..4520356 | 1921 | III: 4518436-4520356 | Caenorhabditis elegans |
