WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00031057 Gene Name  Cbr-pnn-1
Sequence Name  ? CBG09489 Organism  Caenorhabditis briggsae
Automated Description  Is predicted to encode a protein with the following domains: pinin/SDK/memA/ protein conserved region; Pinin; and Pinin/SDK/MemA protein. Is an ortholog of C. elegans pnn-1. Biotype  SO:0001217
Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

16 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG09489a.1 CBG09489a.1   [unknown]
Transcript:CBG09489a.2 CBG09489a.2   [unknown]
Transcript:CBG09489a.3 CBG09489a.3   [unknown]
Transcript:CBG09489a.4 CBG09489a.4   [unknown]
Transcript:CBG09489b.8 CBG09489b.8   [unknown]
Transcript:CBG09489b.9 CBG09489b.9   [unknown]
Transcript:CBG09489b.4 CBG09489b.4   [unknown]
Transcript:CBG09489b.5 CBG09489b.5   [unknown]
Transcript:CBG09489b.6 CBG09489b.6   [unknown]
Transcript:CBG09489b.7 CBG09489b.7   [unknown]
Transcript:CBG09489b.1 CBG09489b.1   [unknown]
Transcript:CBG09489b.2 CBG09489b.2   [unknown]
Transcript:CBG09489b.3 CBG09489b.3   [unknown]
Transcript:CBG09489b.10 CBG09489b.10   [unknown]
Transcript:CBG09489b.12 CBG09489b.12   [unknown]
Transcript:CBG09489b.11 CBG09489b.11   [unknown]
 

Other

2 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG09489a CBG09489a   [unknown]
CDS:CBG09489b CBG09489b   [unknown]

0 RNAi Result

1 Allele

Public Name
WBVar00011052

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

1 Expression Clusters

Regulated By Treatment Description Algorithm Primary Identifier
  Transcripts that showed significantly decreased expression in day 9 adults of C.briggsae AF16 comparing to in day 6 adults of AF16. DESeq2, p < 0.01, fold change > 2. WBPaper00068053:CBG_Day9_vs_Day6_downregulated

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CBG09489, AAAACAAAGACGAATCCACCAATCTACTGGCAGCCAGTGAAGCATACTGTCCGTTCGATG, WBGene00031057   Expr1062777 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region