WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00006408 Gene Name  tag-18
Sequence Name  ? T14G12.3 Organism  Caenorhabditis elegans
Automated Description  Enriched in ABalppappa; ABarappppa; germ line; intestine; and muscle cell based on proteomic; Chronogram; tiling array; RNA-seq; single-cell RNA-seq; and microarray studies. Is affected by several genes including nuo-6; mut-16; and qui-1 based on microarray; tiling array; RNA-seq; and proteomic studies. Is affected by sixteen chemicals including D-glucose; Psoralens; and allantoin based on RNA-seq and microarray studies. Is predicted to encode a protein with the following domain: Phosphorylation site. Biotype  SO:0001217
Genetic Position  X :-9.6372 ±0.03819 Length (nt)  ? 2143
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis elegans 6239

1 Synonyms

Value
WBGene00006408

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:T14G12.3.1 T14G12.3.1 1393   X: 3731894-3734036
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:T14G12.3 T14G12.3 606   X: 3732061-3732101

3 RNAi Result

WormBase ID
WBRNAi00053341
WBRNAi00018724
WBRNAi00035578

40 Allele

Public Name
gk963725
gk964260
gk950987
gk950988
h17312
gk108
gk109
gk674876
gk713423
gk913213
gk668608
gk772708
gk345808
gk762240
gk574643
gk409134
gk276514
gk320523
gk276513
gk558506
gk276512
gk504484
gk276511
gk276510
gk454097
gk276509
gk823503
gk276508
gk599465
pk303

1 Chromosome

WormBase ID Organism Length (nt)
X Caenorhabditis elegans 17718942  

1 Chromosome Location


Feature . Primary Identifier 		Start End Strand
WBGene00006408 3731894 3734036 -1

2 Data Sets

Name URL
WormBaseAcedbConverter  
C. elegans genomic annotations (GFF3 Gene)  

0 Downstream Intergenic Region

271 Expression Clusters

Regulated By Treatment Description Algorithm Primary Identifier
  Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons. DESeq. False discovry rate (FDR) < 0.1. WBPaper00048988:neuron_expressed
  Transcripts that showed significantly increased expression glp-1(e2141); TU3401 animals comparing to in TU3401 animals. Fold change > 2, FDR < 0.01. WBPaper00065993:glp-1(e2141)_upregulated
adult vs dauer larva Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C. N.A. WBPaper00050488:adult_vs_dauer_regulated_N2_20C
  TGF- Dauer pathway adult transcriptional targets. Results obtained by comparing the microarray results of the dauer-constitutive mutants daf-7(e1372), daf-7(m62), and daf-1(m40) with dauer-defective mutants daf-3(mgDf90), daf-5(e1386), and daf-7(e1372);daf-3(mgDf90) double mutants at the permissive temperature, 20C, on the first day of adulthood. SAM WBPaper00031040:TGF-beta_adult_upregulated
  Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:AVE-neuron_L1-larva_expressed
Osmotic stress Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when food was present DESeq(version 1.10.1), FDR < 0.05. WBPaper00050726:OsmoticStress_regulated_Food
  Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:bodywall-muscle_L1-larva_expressed
Bacteria infection: Enterococcus faecalis OG1RF. Exposure for 16 hours. Transcripts that showed significantly decreased expression in N2 after animals were exposed to E. faecalis OG1RF for 16 hours comparing to exposure to E. Coli OP50. Cuffcompare and Cuffdiff WBPaper00056090:E.faecalis_downregulated_N2
  Proteins detected in isolated mitochondria. N.A. WBPaper00067939:mitochondria_expressed_protein
  Transcripts expressed in GABAergic neuron, according to PAT-Seq analysis using Punc-47-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:GABAergic-neuron_expressed
  Proteins interacting with NHR-49-GFP according to co-IP and LC-MS. N.A. WBPaper00064071:NHR-49_interacting
  Transcripts expressed in NMDA neuron, according to PAT-Seq analysis using Pnmr-1-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:NMDA-neuron_expressed
  Genes up regulated in alg-1(gk214) comparing to in N2. Differential expression was assessed using an empirical Bayes statistics using the eBayes function. WBPaper00040823:alg-1(gk214)_upregulated
  Transcripts that showed significantly decreased expression at 5-days-post L4 adult N2 hermaphrodites comparing to 1-day-post L4 adult N2 hermaphrodites. DESeq2, fold change > 2, FDR < 0.05 WBPaper00065835:Day5_vs_Day1_downregulated
  Genes with expression level regulated by genotype (N2 vs CB4856) and age at old adults stage (214 hours at 24 centigrade). For model 2, authors used 100 permutations to estimate the FDR threshold. Per permutation, genotypes and ages were independently randomly distributed, keeping the among-gene structure intact. Then for each spot (23,232) on the array, model 2 was tested. The obtained P-values were used to estimate a threshold for each of the explanatory factors. Authors also used a genome-wide threshold of -log10 P-value = 2, which resembles an FDR of 0.072 and 0.060 for marker and the interaction age-marker for the developing worms and FDR of 0.050 and 0.065 for marker and age-marker for the aging worms. For the physiological age effect, authors used a log10 P-value = 8 in developing worms (0.012 FDR) and -log10 P-value = 6 (0.032 FDR). WBPaper00040858:eQTL_age_regulated_aging
  Transcripts that showed significantly decreased expression at 11-days-post L4 adult N2 hermaphrodites comparing to 1-day-post L4 adult N2 hermaphrodites. DESeq2, fold change > 2, FDR < 0.05 WBPaper00065835:Day11_vs_Day1_downregulated
  Transcripts that showed significantly increased expression in day 1 adult hermaphrodite comparing to in L4 larva daf-16(mu86);glp-1(e2141) animals. Fold change > 2, FDR < 0.05 WBPaper00064088:Day-1-adult_vs_L4_upregulated_daf-16(mu86);glp-1(e2141)
mitochondrial sulfide delivery molecule (mtH2S) AP39 Transcripts that showed significantly increased expression in N2 animals treated with mitochondrial sulfide delivery molecule (mtH2S) AP39 starting from 1-day-post L4 until 11 days post L4. DESeq2, fold change > 2, FDR < 0.05 WBPaper00065835:mtH2S-AP39-D0-treatment_upregulated_Day11
  Transcripts that showed significantly decreased expression in day 3 adult hermaphrodite comparing to in L4 larva glp-1(e2141) animals. Fold change > 2, FDR < 0.05 WBPaper00064088:Day-3-adult_vs_L4_downregulated_glp-1(e2141)
mitochondrial sulfide delivery molecule (mtH2S) AP39 Transcripts that showed significantly increased expression in N2 animals treated with mitochondrial sulfide delivery molecule (mtH2S) AP39 starting from L1 larva until 11-days-post-L4 adult. DESeq2, fold change > 2, FDR < 0.05 WBPaper00065835:mtH2S-AP39-L1-treatment_upregulated_Day11
  Transcripts that showed significantly increased expression in whole animal day 1 N2 adults comparing to in whole animal day 8 N2 adults. DESeq2, FDR < 0.05, fold change > 2. WBPaper00066978:Day1Adult_vs_Day8Adult_upregulated_neuron
  Transcipts that showed significantly decreased expression in old (days 24, 14, and 9 of adulthood) octr-1(ok371) comparing to in N2 at 25C. DESeq2 v1.31.16, fold change > 2, FDR < 0.05 WBPaper00068082:octr-1(ok371)_downregulated_old_25C
Bacteria: Pseudomonas donghuensis HYS Transcripts that showed significantly increased expression after 24 hours of infection by Pseudomonas donghuensis HYS with deletion of ferric uptake regulator (FUR), comparing to control animals exposed to HYS. DESeq2, fold change > 2, FDR < 0.05. WBPaper00068216:FUR_vs_HYS_upregulated
Bacteria infection: Enterococcus faecalis OG1RF. 16 hours of exposure after L4 larva stage at 25C. Transcripts that showed significantly decreased expression in N2 animals fed by E. faecalis strain OG1RF for 16 hours after L4 larva stage at 25C. DESeq2, fold change > 2. WBPaper00061081:E.faecalis_downregulated_N2
Bacteria: Pseudomonas donghuensis HYS Transcripts that showed significantly increased expression after 24 hours of infection by Pseudomonas donghuensis HYS with deletion of ferric uptake regulator (FUR), comparing to control animals exposed to OP50. DESeq2, fold change > 2, FDR < 0.05. WBPaper00068216:FUR_vs_OP50_upregulated
Bacteria infection: Enterococcus faecalis OG1RF. 16 hours of exposure after L4 larva stage at 25C. Transcripts that showed significantly decreased expression in skpo-1(ok1640) animals fed by E. faecalis strain OG1RF for 16 hours after L4 larva stage at 25C. DESeq2, fold change > 2. WBPaper00061081:E.faecalis_downregulated_skpo-1(ok1640)
Bacteria: Pseudomonas donghuensis HYS Transcripts that showed significantly decreased expression after 24 hours of infection by Pseudomonas donghuensis HYS, comparing to control animals exposed to OP50. DESeq2, fold change > 2, FDR < 0.05. WBPaper00068216:HYS_vs_OP50_downregulated
Bacteria infection: Bacillus thuringiensis mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 10 mix) vs BT407 12h), according to RNAseq. Cuffdiff, ajusted p-value < 0.01. WBPaper00046497:B.thuringiensis_0.1mix_downregulated_12h
Bacteria infection: Bacillus thuringiensis Transcripts that showed significantly increased expression in N2 animals infected by bacteria BMB171/Cry5Ba, an acrystalliferous Bt mutant BMB171 transformed with toxin gene cry5Ba on the shuttle vector pHT304, comparing to N2 animals infected by BMB171/pHT304. N.A. WBPaper00064229:B.thuringiensis-Cry5Ba_upregulated
Bacteria infection: Bacillus thuringiensis mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 2 mix) vs BT407 12h), according to RNAseq. Cuffdiff, ajusted p-value < 0.01. WBPaper00046497:B.thuringiensis_0.5mix_downregulated_12h

7 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
    Expr2035374 Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).  
Also expressed in (comments from author) : No comments. Strain: BC14940 [tag-18::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTGAAAGCGATGAAGTCCG] 3' and primer B 5' [GAAGGGATGGCAGTACTTTGTC] 3'. Expr6697 Adult Expression: anal depressor muscle; Reproductive System; vulval muscle; body wall muscle; Larval Expression: anal depressor muscle; body wall muscle;  
    Expr1032600 Tiling arrays expression graphs  
Original chronogram file: chronogram.1937.xml [T14G12.3:gfp] transcriptional fusion. Chronogram891    
    Expr1156927 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015  
    Expr2017238 Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).  
    Expr1027715 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

1 Locations


Feature . Primary Identifier 		Start End Strand
WBGene00006408 3731894 3734036 -1

0 Ontology Annotations

0 Regulates Expr Cluster

1 Sequence

Length
2143

1 Sequence Ontology Term

Identifier Name Description
gene  

4 Strains

WormBase ID
WBStrain00035574
WBStrain00035577
WBStrain00035726
WBStrain00003306

1 Upstream Intergenic Region

WormBase ID Name Sequence Name Length (nt) Chromosome Location Organism
intergenic_region_chrX_3734037..3735474   1438 X: 3734037-3735474 Caenorhabditis elegans