WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00019896 Gene Name  R05G6.1
Sequence Name  ? R05G6.1 Organism  Caenorhabditis elegans
Automated Description  Enriched in excretory gland cell; head mesodermal cell; neurons; rectal epithelial cell; and in male based on tiling array; RNA-seq; single-cell RNA-seq; and microarray studies. Is affected by several genes including cyc-1; swsn-2.2; and dve-1 based on microarray and RNA-seq studies. Is affected by five chemicals including Psoralens; allantoin; and Sirolimus based on RNA-seq studies. Biotype  SO:0001217
Genetic Position  :± Length (nt)  ? 9601
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis elegans 6239

1 Synonyms

Value
WBGene00019896

Genomics

3 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:R05G6.1.1 R05G6.1.1 1336   IV: 7532660-7542260
Transcript:R05G6.1.2 R05G6.1.2 1409   IV: 7537876-7542260
Transcript:R05G6.1.3 R05G6.1.3 1224   IV: 7539577-7542260
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:R05G6.1 R05G6.1 738   IV: 7539699-7539757

3 RNAi Result

WormBase ID
WBRNAi00051321
WBRNAi00034624
WBRNAi00017461

95 Allele

Public Name
gk964278
gk964500
gk963722
gk963417
gk963416
WBVar02020891
WBVar02020890
WBVar00035686
h13753
cxTi9548
WBVar00190715
WBVar00190716
WBVar00190719
WBVar00190717
WBVar00190718
WBVar00190724
WBVar00190722
WBVar00190723
WBVar00190720
WBVar00190721
gk205679
gk205680
gk205677
gk205678
gk205672
gk205673
gk205671
gk205676
gk205674
gk205675

1 Chromosome

WormBase ID Organism Length (nt)
IV Caenorhabditis elegans 17493829  

1 Chromosome Location


Feature . Primary Identifier 		Start End Strand
WBGene00019896 7532660 7542260 1

2 Data Sets

Name URL
WormBaseAcedbConverter  
C. elegans genomic annotations (GFF3 Gene)  

0 Downstream Intergenic Region

94 Expression Clusters

Regulated By Treatment Description Algorithm Primary Identifier
  Transcripts that showed significantly increased expression in L1 neural cells comparing to in adult neural cells. DESeq2 (v1.18.1) fold change > 2, P-adj<0.05, using BenjaminiHochberg correction. WBPaper00060811:L1_vs_adult_upregulated_neural
  Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons. DESeq. False discovry rate (FDR) < 0.1. WBPaper00048988:neuron_expressed
  Transcripts that showed significantly increased expression glp-1(e2141); TU3401 animals comparing to in TU3401 animals. Fold change > 2, FDR < 0.01. WBPaper00065993:glp-1(e2141)_upregulated
  Transcripts of coding genes that showed significantly decreased expression in muscle. DESeq2 (version 1.24.0). Transcripts with a false-discovery rate adjusted p-value less than 0.05 were considered significantly differentially expressed. WBPaper00062325:muscle_depleted_coding-RNA
adult vs dauer larva Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C. N.A. WBPaper00050488:adult_vs_dauer_regulated_N2_20C
  TGF- Dauer pathway adult transcriptional targets. Results obtained by comparing the microarray results of the dauer-constitutive mutants daf-7(e1372), daf-7(m62), and daf-1(m40) with dauer-defective mutants daf-3(mgDf90), daf-5(e1386), and daf-7(e1372);daf-3(mgDf90) double mutants at the permissive temperature, 20C, on the first day of adulthood. SAM WBPaper00031040:TGF-beta_adult_upregulated
  Neuronally enriched transcripts according to a comparison of neuronal nuclei IP samples to total nuclei using isolation of nuclei from tagged specific cell types (INTACT) technology. DESEQ2, fold change > 2 and FDR < 0.01. WBPaper00062103:neuron_enriched
  Genome-wide analysis of developmental and sex-regulated gene expression profile. self-organizing map cgc4489_group_18
  Transcripts that showed altered expression in cat-1(RNAi) animals comparing to control animals injected with empty vector. p-value <= 0.05 WBPaper00066902:cat-1(RNAi)_regulated
  Significantly upregulated genes from clk-1(qm30) microarrays using SAM algorithm with an FDR < 0.1 from adult-only chips. SAM algorithm with an FDR < 0.1. WBPaper00033065:clk-1(qm30)_upregulated
  Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:all-neurons_L2-larva_expressed
  Transcripts that showed significantly increased expression in hda-2(ok1479) comparing to in N2 animals. DESeq2 (version 1.28.1), FDR < 0.01, fold change > 2. WBPaper00062159:hda-2(ok1479)_upregulated
  Transcripts that showed significantly increased expression in srbc-48(ac23);kyIs262;fer-1(b232ts) comparing to in kyIs262;fer-1(b232ts), 24h after infection with P.aeruginosa. DESeq2, FDR <0.05, fold change > 2. WBPaper00059664:srbc-48(ac23)_upregulated
  Transcripts that showed significantly decreased expression in eat-2(ad1116) comparing to in N2 at 3-days post L4 adult hermaphrodite animals. DESeq2(v1.14.1), fold change > 2, p-value < 0.05 WBPaper00055354:eat-2(ad1116)_downregulated
  Transcripts that showed significantly decreased expression after animals were treated with 100uM Psora and 250uM Allantoin from day 1 to day 3 adult hermaphradite. DESeq2(v1.14.1), fold change > 2, p-value < 0.05 WBPaper00055354:Psora-Allantoin_downregulated
  Transcripts that showed significantly decreased expression after animals were treated with 100uM Rapamycin and 50uM Rifampicin from day 1 to day 3 adult hermaphradite. DESeq2(v1.14.1), fold change > 2, p-value < 0.05 WBPaper00055354:Rapamycin-Rifampicin_downregulated
  Transcripts that showed significantly decreased expression after animals were treated with 50uM Rifampicin and 250uM Allantoin from day 1 to day 3 adult hermaphradite. DESeq2(v1.14.1), fold change > 2, p-value < 0.05 WBPaper00055354:Rifampicin-Allantoin_downregulated
Bacteria: B.thuringiensis Transcripts in elt-2(RNAi) animals that were significantly differentially expressed at least for one time point and one pathogenic strain Bt247 and Bt679 compared to the non pathogenic strain Bt407. Cuffdiff WBPaper00060358:B.thuringiensis_pathogen_regulated_elt-2(RNAi)
  Proteins identified in extracellular vesicle. N.A. WBPaper00062669:extracellular-vesicle_protein
  Transcipts that showed significantly increased expression in old (days 24, 14, and 9 of adulthood) octr-1(ok371) comparing to in N2 at 25C. DESeq2 v1.31.16, fold change > 2, FDR < 0.05 WBPaper00068082:octr-1(ok371)_upregulated_old_25C
  Genes expressed in N2. Expressed transcripts were identified on the basis of a Present call in 3 out of 4 N2 experiments as determined by Affymetrix MAS 5.0. WBPaper00025141:N2_Expressed_Genes
  Transcripts that showed significantly decreased expression in whole animal day 1 N2 adults comparing to in whole animal day 8 N2 adults. DESeq2, FDR < 0.05, fold change > 2. WBPaper00066978:Day1Adult_vs_Day8Adult_downregulated_neuron
  Transcripts that showed significantly decreased expression in aak-1(tm1944);aak-2(ok524) animals comparing to in N2. DEseq 1.18.0, adjusted p-value < 0.05. WBPaper00056471:aak-1(tm1944);aak-2(ok524)_downregulated
  Transcripts that showed significantly decreased expression in nhr-114(gk849) comparing to wild type animals at L4 larva. DESeq2 1.26.0, fold change > 2, FDR < 0.05. WBPaper00064539:nhr-114(gk849)_downregulated
  Transcripts that showed significantly decreased expression in eat-2(ad465);dve-1(RNAi) animals comparing to eat-2(ad465) animals injected with empty vector. fold change > 2, FDR < 0.01 WBPaper00067391:dve-1(RNAi)_downregulated_eat-2(ad465)
20C vs 25C Transcripts that showed differential expression in 20C vs 25C in N2 animals at adult stage. N.A. WBPaper00050488:20C_vs_25C_regulated_N2_adult
  Transcripts that showed significantly decreased expression in npp-14(ax4543) comparing to in N2. DESeq2. Statistically significant genes were chosen based on a BenjaminiHochberg adjusted P-value of 0.05. WBPaper00067885:npp-14(ax4543)_downregulated
  Significantly upregulated genes from cyc-1(RNAi) microarrays using SAM algorithm with an FDR < 0.1 from adult-only chips. SAM algorithm with an FDR < 0.1. WBPaper00033065:cyc-1(RNAi)_upregulated
  Genes with significant increase of expression in NBAS smgl-1(RNAi) comparing to control. Bioconductor package LIMMA was used to determine differentially expressed genes. The P-values were adjusted for multiple testing with a false-discovery rate (50). Probe sets with fold-change > 1.5 and q-value < 0.05 were used as a cut-off for C. elegans microarrays WBPaper00042561:smgl-1(RNAi)_upregulated
  Genes eniched in hermaphrodites by comparing tra-2(ar221ts);xol-1(y9) XX phenotype males (at 25C) with either N2 or xol-1(y9) XX hermaphrodites during L4 larva stage Student t-test. An mRNA was considered to have sex-enriched expression if it showed at least a two-fold enrichment within a 99% confidence interval (P < 0.01). WBPaper00026629:L4_male_enriched

6 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Strain: BC12310 [R05G6.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TCTGAATCCAATCGTCACCTATT] 3' and primer B 5' [ACGTTGGATAGAATGCGAATAAA] 3'. Expr6464 Adult Expression: intestine; rectal gland cells; Nervous System; head neurons; amphids; tail neurons; phasmids; Larval Expression: intestine; rectal gland cells; Nervous System; head neurons; amphids; tail neurons; phasmids;  
    Expr2023627 Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).  
Original chronogram file: chronogram.1640.xml [R05G6.1:gfp] transcriptional fusion. Chronogram611    
    Expr1155013 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015  
    Expr1022207 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
    Expr2005406 Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).  

0 GO Annotation

0 Homologues

1 Locations


Feature . Primary Identifier 		Start End Strand
WBGene00019896 7532660 7542260 1

0 Ontology Annotations

0 Regulates Expr Cluster

1 Sequence

Length
9601

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region