WormBase Gene ID
|
WBGene00213204 | Gene Name | CJA37357 |
| Sequence Name
|
CJA37357 | Organism | Caenorhabditis japonica |
| Automated Description | Predicted to enable dynein intermediate chain binding activity; dynein light intermediate chain binding activity; and minus-end-directed microtubule motor activity. Predicted to be involved in microtubule-based movement. Predicted to be part of dynein complex. Is an ortholog of C. elegans che-3. In C. elegans, che-3 is involved in several processes, including dauer entry; non-motile cilium assembly; and positive regulation of dauer larval development. | Biotype | SO:0001217 |
| Genetic Position | :± |
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:CJA37357.1 | CJA37357.1 | [unknown] |
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| Cjp-che-3, TCAATGGAGAGCAGATACAAGTACCACTATACAGTTCAAACGATCGTTCGGATTTGGTCA, WBGene00121012 | Expr1072360 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |
Powered by
