WormBase Gene ID
|
WBGene00182606 | Gene Name | Cjp-eif-3.F |
| Sequence Name
|
CJA27034 | Organism | Caenorhabditis japonica |
| Automated Description | Predicted to enable metallopeptidase activity; translation initiation factor activity; and translation initiation factor binding activity. Predicted to be involved in translational initiation. Predicted to be part of eukaryotic translation initiation factor 3 complex. Is an ortholog of C. elegans eif-3.F. In C. elegans, eif-3.F is involved in translation. | Biotype | SO:0001217 |
| Genetic Position | :± |
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:CJA27034.1 | CJA27034.1 | [unknown] |
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| Cjp-eif-3.F, ACAAAAATGGCGAGAAACCTGGAGACGCTCAAATTGGCCGCCAGCTCATGGATATTGTCA, WBGene00182606 | Expr1090009 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |
Powered by
