WormBase Gene ID
|
WBGene00182136 | Gene Name | Cjp-rsf-1 |
| Sequence Name
|
CJA26564 | Organism | Caenorhabditis japonica |
| Automated Description | Predicted to be involved in signal transduction. Is an ortholog of C. elegans rsf-1. In C. elegans, rsf-1 is involved in several processes, including chromosome condensation; positive regulation of response to oxidative stress; and regulation of vulval development. | Biotype | SO:0001217 |
| Genetic Position | :± |
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:CJA26564.1 | CJA26564.1 | [unknown] |
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| CJA26564, GTTCTCTCCAGTTGATAGTCTGAAAAAAGAGGCCAGTGCACCTCCAGAGTCAAGGCATGC, WBGene00182136 | Expr1079383 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |
Powered by
