WormBase Gene ID
|
WBGene00176798 | Gene Name | Cjp-unc-11.1 |
| Sequence Name
|
CJA21226 | Organism | Caenorhabditis japonica |
| Automated Description | Predicted to enable 1-phosphatidylinositol binding activity and clathrin binding activity. Predicted to be involved in clathrin coat assembly. Predicted to be located in clathrin-coated vesicle. Is an ortholog of C. elegans unc-11. In C. elegans, unc-11 is involved in several processes, including endocytosis; necroptotic process; and protein localization to postsynaptic membrane. | Biotype | SO:0001217 |
| Genetic Position | :± |
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:CJA21226.1 | CJA21226.1 | [unknown] |
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| Cjp-unc-11, GCGTCAGTTTGAGGACCAAAAGAAGACGATCAACTCGGCGAATCCGTTTGCGAATGATGT, WBGene00176798 | Expr1071088 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |
Powered by
