WormBase Gene ID
|
WBGene00137916 | Gene Name | Cjp-pcm-1 |
| Sequence Name
|
CJA18710 | Organism | Caenorhabditis japonica |
| Automated Description | Predicted to enable protein-L-isoaspartate (D-aspartate) O-methyltransferase activity. Predicted to be involved in protein modification process. Is an ortholog of C. elegans pcm-1. In C. elegans, pcm-1 is involved in multicellular organismal response to stress; regulation of autophagy; and response to starvation. | Biotype | SO:0001217 |
| Genetic Position | :± |
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:CJA18710.1 | CJA18710.1 | [unknown] |
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| Cjp-pcm-1, GAGCCATTCGTGAAACAATGATCGAACATGTTATCTACGTACCTCTAACGAGCCGTGAAA, WBGene00137916 | Expr1088243 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |
Powered by
