WormBase Gene ID
|
WBGene00137508 | Gene Name | Cjp-rec-8 |
| Sequence Name
|
CJA18304 | Organism | Caenorhabditis japonica |
| Automated Description | Predicted to be involved in sister chromatid cohesion. Predicted to be part of cohesin complex. Is an ortholog of C. elegans rec-8. In C. elegans, rec-8 is involved in several processes, including meiotic chromosome segregation; meiotic sister chromatid cohesion; and regulation of centriole-centriole cohesion. | Biotype | SO:0001217 |
| Genetic Position | :± |
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:CJA18304.1 | CJA18304.1 | [unknown] |
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| Cjp-rec-8, GTTAGAAGCGGATGGAGAAGCGGAGGACGATATTTATTTTGTCTCTTCCGGATCTCTGCT, WBGene00137508 | Expr1075897 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |
Powered by
