WormBase Gene ID
|
WBGene00137317 | Gene Name | Cjp-umps-1 |
| Sequence Name
|
CJA18113 | Organism | Caenorhabditis japonica |
| Automated Description | Predicted to enable orotate phosphoribosyltransferase activity and orotidine-5'-phosphate decarboxylase activity. Predicted to be involved in 'de novo' UMP biosynthetic process and 'de novo' pyrimidine nucleobase biosynthetic process. Is an ortholog of C. elegans umps-1. In C. elegans, umps-1 is involved in several processes, including determination of adult lifespan; pyrimidine-containing compound biosynthetic process; and response to radiation. | Biotype | SO:0001217 |
| Genetic Position | :± |
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:CJA18113.1 | CJA18113.1 | [unknown] |
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| Cjp-umps-1, ACTGACGACATTGGCCAACGATATGGACTTTATAATATTTGAAGACCGAAAGTTTGGAGA, WBGene00137317 | Expr1074274 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |
Powered by
