WormBase Gene ID
|
WBGene00135893 | Gene Name | Cjp-mbk-2 |
| Sequence Name
|
CJA16689 | Organism | Caenorhabditis japonica |
| Automated Description | Predicted to enable ATP binding activity and protein serine/threonine/tyrosine kinase activity. Predicted to be involved in protein phosphorylation. Is an ortholog of C. elegans mbk-2. In C. elegans, mbk-2 is involved in several processes, including P granule disassembly; asymmetric protein localization involved in cell fate determination; and positive regulation of proteasomal ubiquitin-dependent protein catabolic process. | Biotype | SO:0001217 |
| Genetic Position | :± |
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:CJA16689.1 | CJA16689.1 | [unknown] |
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| Cjp-mbk-2, GAAACGTGCGCGCACATTCATCTCCTCGAAGGGATATCCACGATACTGCACAGCCACTGC, WBGene00135893 | Expr1080984 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |
Powered by
