WormBase Gene ID
|
WBGene00133545 | Gene Name | Cjp-dhc-1 |
| Sequence Name
|
CJA14341 | Organism | Caenorhabditis japonica |
| Automated Description | Predicted to enable ATP binding activity and minus-end-directed microtubule motor activity. Predicted to be involved in microtubule-based movement. Predicted to be part of dynein complex. Is an ortholog of C. elegans dhc-1. In C. elegans, dhc-1 is involved in several processes, including neuron remodeling; organelle localization; and regulation of cellular localization. | Biotype | SO:0001217 |
| Genetic Position | :± |
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:CJA14341.1 | CJA14341.1 | [unknown] |
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| CJA14684, CCAAACAATGTCAACTGATGATTACGTGGAATGGCTCGACAAGTATCCGTCTCAAGTCAT, WBGene00133888 | Expr1074040 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |
Powered by
