WormBase Gene ID
|
WBGene00133317 | Gene Name | Cjp-nmy-1 |
| Sequence Name
|
CJA14113 | Organism | Caenorhabditis japonica |
| Automated Description | Predicted to enable ATP binding activity; actin filament binding activity; and cytoskeletal motor activity. Predicted to be part of myosin complex. Is an ortholog of C. elegans nmy-1. In C. elegans, nmy-1 is involved in several processes, including nematode larval development; protein localization; and regulation of embryonic cell shape. | Biotype | SO:0001217 |
| Genetic Position | :± |
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:CJA14113.1 | CJA14113.1 | [unknown] |
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| Cjp-nmy-1, GAGAGGACAAAACACAGAACTCTTCAACGTGAAACTGACGACCTCTTGGATGCTAATGAG, WBGene00133317 | Expr1073866 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |
Powered by
