WormBase Gene ID
|
WBGene00131142 | Gene Name | Cjp-unc-54 |
| Sequence Name
|
CJA11938 | Organism | Caenorhabditis japonica |
| Automated Description | Predicted to enable ATP binding activity; actin filament binding activity; and cytoskeletal motor activity. Predicted to be part of myosin complex. Is an ortholog of C. elegans unc-54. In C. elegans, unc-54 is involved in several processes, including egg-laying behavior; muscle contraction; and skeletal muscle myosin thick filament assembly. | Biotype | SO:0001217 |
| Genetic Position | :± |
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:CJA11938.1 | CJA11938.1 | [unknown] |
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| CJA08518, CAGGACCTGATTGACAAGCTCCAGCAGAAGTTGAAGACCCAGAAGAAGCAGGTTGAGGAA, WBGene00127722 | Expr1076838 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |
Powered by
