WormBase Gene ID
|
WBGene00131039 | Gene Name | Cjp-cdk-7 |
| Sequence Name
|
CJA11835 | Organism | Caenorhabditis japonica |
| Automated Description | Predicted to enable ATP binding activity and RNA polymerase II CTD heptapeptide repeat kinase activity. Predicted to be involved in protein phosphorylation. Predicted to be part of transcription factor TFIIK complex. Is an ortholog of C. elegans cdk-7. In C. elegans, cdk-7 is involved in mRNA transcription and mitotic cell cycle, embryonic. | Biotype | SO:0001217 |
| Genetic Position | :± |
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:CJA11835.1 | CJA11835.1 | [unknown] |
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| Cjp-cdk-7, AACCAACCATTCTGCTGTTTGGACGAAGAGCTTCCACTTCCGAATCAACAACCACAAAAA, WBGene00131039 | Expr1074346 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |
Powered by
