WormBase Gene ID
|
WBGene00130997 | Gene Name | Cjp-tbx-2 |
| Sequence Name
|
CJA11793 | Organism | Caenorhabditis japonica |
| Automated Description | Predicted to enable DNA-binding transcription factor activity and RNA polymerase II cis-regulatory region sequence-specific DNA binding activity. Predicted to be involved in regulation of DNA-templated transcription. Predicted to be located in nucleus. Is an ortholog of C. elegans tbx-2. In C. elegans, tbx-2 is involved in several processes, including muscle structure development; neuron migration; and olfactory behavior. | Biotype | SO:0001217 |
| Genetic Position | :± |
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:CJA11793.1 | CJA11793.1 | [unknown] |
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| Cjp-tbx-2, AAAATCAACCCCACGCGAAAAATTCGTCATCACGCCACCAAAGAAGGGCGGTTTCGACGT, WBGene00130997 | Expr1080393 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |
Powered by
