WormBase Gene ID
|
WBGene00130096 | Gene Name | Cjp-mek-1 |
| Sequence Name
|
CJA10892 | Organism | Caenorhabditis japonica |
| Automated Description | Predicted to enable ATP binding activity and protein kinase activity. Predicted to be involved in protein phosphorylation. Is an ortholog of C. elegans mek-1. In C. elegans, mek-1 is involved in several processes, including MAPK cascade; gamete generation; and response to metal ion. | Biotype | SO:0001217 |
| Genetic Position | :± |
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:CJA10892.1 | CJA10892.1 | [unknown] |
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| Cjp-mek-1, CAGCACCCGTTCATTCTATTCCACGAGCAACAAGAAACTGACGTTGAGGAATGGTTCGCT, WBGene00130096 | Expr1084255 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |
Powered by
