WormBase Gene ID
|
WBGene00129859 | Gene Name | Cjp-ces-2 |
| Sequence Name
|
CJA10655 | Organism | Caenorhabditis japonica |
| Automated Description | Predicted to enable DNA-binding transcription factor activity. Predicted to be involved in regulation of transcription by RNA polymerase II. Is an ortholog of C. elegans ces-2. In C. elegans, ces-2 is involved in several processes, including apoptotic process; positive regulation of programmed cell death; and positive regulation of transcription by RNA polymerase II. | Biotype | SO:0001217 |
| Genetic Position | :± |
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:CJA10655.1 | CJA10655.1 | [unknown] |
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| Cjp-ces-2, CAGGAGAACATTCAACTACGAGGACAAATCACGATTCTGCAACAGGAGGCGGCCAAGCTC, WBGene00129859 | Expr1072830 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |
Powered by
