WormBase Gene ID
|
WBGene00128514 | Gene Name | Cjp-aex-2 |
| Sequence Name
|
CJA09311 | Organism | Caenorhabditis japonica |
| Automated Description | Predicted to enable neuropeptide receptor activity. Predicted to be involved in neuropeptide signaling pathway. Predicted to be located in membrane. Is an ortholog of C. elegans aex-2. In C. elegans, aex-2 is involved in several processes, including lipid transport involved in lipid storage; positive regulation of digestive system process; and positive regulation of triglyceride transport. | Biotype | SO:0001217 |
| Genetic Position | :± |
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:CJA09311.1 | CJA09311.1 | [unknown] |
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| Cjp-aex-2, GCATCAGTTTGGGACTCATTTTTGGTCGGTTACGTGAGAACAGCTCAACAGAGGTGCTAA, WBGene00128514 | Expr1072776 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |
Powered by
