WormBase Gene ID
|
WBGene00128438 | Gene Name | Cjp-mlt-7 |
| Sequence Name
|
CJA09235 | Organism | Caenorhabditis japonica |
| Automated Description | Predicted to enable heme binding activity and peroxidase activity. Predicted to be involved in response to oxidative stress. Is an ortholog of C. elegans mlt-7. In C. elegans, mlt-7 is involved in cuticle development involved in collagen and cuticulin-based cuticle molting cycle; nematode larval development; and post-embryonic body morphogenesis. | Biotype | SO:0001217 |
| Genetic Position | :± |
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:CJA09235.1 | CJA09235.1 | [unknown] |
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| Cjp-mlt-7, GGACTAGTCGGCACCACGTTGAGCTGTGTGATTGGCGAGCAGTTCAAGAGGGCCAGAGAT, WBGene00128438 | Expr1073369 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |
Powered by
