WormBase Gene ID
|
WBGene00127532 | Gene Name | Cjp-nhr-31 |
| Sequence Name
|
CJA08328 | Organism | Caenorhabditis japonica |
| Automated Description | Predicted to enable DNA-binding transcription factor activity; sequence-specific DNA binding activity; and zinc ion binding activity. Predicted to be involved in regulation of DNA-templated transcription. Is an ortholog of C. elegans nhr-31. In C. elegans, nhr-31 is involved in embryo development; post-embryonic animal morphogenesis; and response to osmotic stress. | Biotype | SO:0001217 |
| Genetic Position | :± |
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:CJA08328.1 | CJA08328.1 | [unknown] |
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| Cjp-nhr-31, GTCTGAAAACATGCACTTTTGCCAAGCCCTTGGAGGTCGTGCCAGTGGAGACAATCTTCT, WBGene00127532 | Expr1087450 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |
Powered by
