WormBase Gene ID
|
WBGene00125097 | Gene Name | Cjp-myo-1 |
| Sequence Name
|
CJA05893 | Organism | Caenorhabditis japonica |
| Automated Description | Predicted to enable ATP binding activity; actin filament binding activity; and cytoskeletal motor activity. Predicted to be part of myosin complex. Is an ortholog of C. elegans myo-1. In C. elegans, myo-1 is involved in muscle contraction and nematode pharyngeal pumping. | Biotype | SO:0001217 |
| Genetic Position | :± |
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:CJA05893.1 | CJA05893.1 | [unknown] |
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| Cjp-let-75, CAGATCCAACTCGCTCTCGAGAATGCCGAAGAGCGTGCCGAGGTCGCCGAAAACTCACTT, WBGene00125097 | Expr1086208 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |
Powered by
