WormBase Gene ID
|
WBGene00124277 | Gene Name | CJA05073 |
| Sequence Name
|
CJA05073 | Organism | Caenorhabditis japonica |
| Automated Description | Predicted to enable transmembrane transporter activity. Predicted to be involved in transmembrane transport. Is an ortholog of C. elegans eat-4. In C. elegans, eat-4 is involved in several processes, including glutamatergic synaptic transmission; positive regulation of backward locomotion; and regulation of male mating behavior. | Biotype | SO:0001217 |
| Genetic Position | :± |
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:CJA05073.1 | CJA05073.1 | [unknown] |
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| Cjp-eat-4, GCTATCCGGCAATGCACGGTGTTTGGAGATATTGGGCGCCTCCTATGGAACGATCAAAAC, WBGene00124277 | Expr1081042 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |
Powered by
