WormBase Gene ID
|
WBGene00123586 | Gene Name | CJA04382 |
| Sequence Name
|
CJA04382 | Organism | Caenorhabditis japonica |
| Automated Description | Predicted to enable NAD binding activity; NADP binding activity; and oxidoreductase activity, acting on the aldehyde or oxo group of donors, NAD or NADP as acceptor. Predicted to be involved in glucose metabolic process. Is an ortholog of C. elegans gpd-1 and gpd-4. | Biotype | SO:0001217 |
| Genetic Position | :± |
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:CJA04382.1 | CJA04382.1 | [unknown] |
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| CJA04382, AAAATACGACGCATCCAATGATCACGTCATCTCGAACGCCTCCTGTACAACAAATTGTCT, WBGene00123586 | Expr1072670 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |
Powered by
