WormBase Gene ID
|
WBGene00120922 | Gene Name | Cjp-riok-1 |
| Sequence Name
|
CJA01718 | Organism | Caenorhabditis japonica |
| Automated Description | Predicted to enable ATP binding activity and protein serine/threonine kinase activity. Is an ortholog of C. elegans riok-1. In C. elegans, riok-1 is involved in several processes, including gamete generation; positive regulation of vulval development; and regulation of intracellular signal transduction. | Biotype | SO:0001217 |
| Genetic Position | :± |
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:CJA01718.1 | CJA01718.1 | [unknown] |
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| CJA01718, AAAGATTGCGATGCATACGCGGAATCGTGAGGAGACCACCGATGAGCGGAAATTGAGGAA, WBGene00120922 | Expr1084814 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |
Powered by
