WormBase Gene ID
|
WBGene00119617 | Gene Name | Cjp-dpy-23 |
| Sequence Name
|
CJA00413 | Organism | Caenorhabditis japonica |
| Automated Description | Predicted to be involved in intracellular protein transport and vesicle-mediated transport. Predicted to be part of clathrin adaptor complex. Is an ortholog of C. elegans dpy-23. In C. elegans, dpy-23 is involved in several processes, including necroptotic process; positive regulation of Wnt protein secretion; and protein localization to non-motile cilium. | Biotype | SO:0001217 |
| Genetic Position | :± |
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:CJA00413.1 | CJA00413.1 | [unknown] |
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| Cjp-dpy-23, GGTGCGCATTCCAACGCCACCAAACACGTCGGGTGTGCAATTGATTTGTATGAAAGGAAA, WBGene00119617 | Expr1081324 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |
Powered by
