WormBase Gene ID
|
WBGene00119497 | Gene Name | CJA00296 |
| Sequence Name
|
CJA00296 | Organism | Caenorhabditis japonica |
| Automated Description | Predicted to enable ATP binding activity and protein kinase activity. Predicted to be involved in protein phosphorylation. Is an ortholog of C. elegans Y105C5A.24 and mom-4. In C. elegans, mom-4 is involved in several processes, including cell fate commitment; embryonic digestive tract morphogenesis; and signal transduction. | Biotype | SO:0001217 |
| Genetic Position | :± |
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:CJA00296.1 | CJA00296.1 | [unknown] |
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| CJA00296, CATTTACTAATCTTCACCAATCAATGACTTCGAATCGCGGTACGCCTATCACAATGGCAC, WBGene00119497 | Expr1087758 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |
Powered by
