Genomics
1 Transcripts
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:CBG28048.1 | CBG28048.1 | [unknown] |
Other
11 Allele
| Public Name |
|---|
| WBVar00112607 |
| WBVar00112606 |
| WBVar00112597 |
| WBVar00112599 |
| WBVar00112598 |
| WBVar00112601 |
| WBVar00112600 |
| WBVar00112603 |
| WBVar00112602 |
| WBVar00112605 |
| WBVar00112604 |
2 Expression Clusters
| Regulated By Treatment | Description | Algorithm | Primary Identifier |
|---|---|---|---|
| Transcripts that showed significantly increased expression in day 9 adults of C.briggsae AF16 comparing to in day 6 adults of AF16. | DESeq2, p < 0.01, fold change > 2. | WBPaper00068053:CBG_Day9_vs_Day6_upregulated | |
| Transcripts that showed significantly increased expression in day 9 adults of C.briggsae AF16 comparing to in day 1 adults of AF16. | DESeq2, p < 0.01, fold change > 2. | WBPaper00068053:CBG_Day9_vs_Day1_upregulated |
1 Expression Patterns
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| CBG28048, GGGTAACCTGGAAGTGTGTACCTGCGATGGAAACTTGTGTAATAGTGAAGCATCTCTTAA, WBGene00089462 | Expr1050499 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |
