Genomics
2 Transcripts
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:CBG26259a.1 | CBG26259a.1 | [unknown] | |
| Transcript:CBG26259b.1 | CBG26259b.1 | [unknown] |
Other
2 CDSs
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| CDS:CBG26259b | CBG26259b | [unknown] | |
| CDS:CBG26259a | CBG26259a | [unknown] |
8 Allele
| Public Name |
|---|
| WBVar00138875 |
| WBVar00138878 |
| WBVar00138879 |
| WBVar00138876 |
| WBVar00138877 |
| WBVar00138881 |
| WBVar00138882 |
| WBVar00138880 |
3 Expression Clusters
| Regulated By Treatment | Description | Algorithm | Primary Identifier |
|---|---|---|---|
| Transcripts that showed significantly increased expression in day 9 adults of C.briggsae AF16 comparing to in day 6 adults of AF16. | DESeq2, p < 0.01, fold change > 2. | WBPaper00068053:CBG_Day9_vs_Day6_upregulated | |
| Transcripts that showed significantly decreased expression in day 6 adults of C.briggsae AF16 comparing to in day 1 adults of AF16. | DESeq2, p < 0.01, fold change > 2. | WBPaper00068053:CBG_Day6_vs_Day1_downregulated | |
| Transcripts that showed significantly increased expression in day 9 adults of C.briggsae AF16 comparing to in day 1 adults of AF16. | DESeq2, p < 0.01, fold change > 2. | WBPaper00068053:CBG_Day9_vs_Day1_upregulated |
2 Expression Patterns
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| CBG26259, TACTTTCACACCTACAAAAAAGTCAATCGAACGAGACGTCACACGATTGCGGAGTGCTGT, WBGene00087673 | Expr1070260 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 | ||
| CBG18730, CAATAAGTGGACATTGCTCATGCCAACCAGGATGGAGGGGCAAGAAGTGCAATCGACGTA, WBGene00038099 | Expr1063509 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |
