WormBase Gene ID
|
WBGene00086404 | Gene Name | Cre-tpk-1 |
| Sequence Name
|
CRE12196 | Organism | Caenorhabditis remanei |
| Automated Description | Predicted to enable ATP binding activity; thiamine binding activity; and thiamine diphosphokinase activity. Predicted to be involved in thiamine diphosphate biosynthetic process and thiamine metabolic process. Is an ortholog of C. elegans tpk-1. | Biotype | SO:0001217 |
| Genetic Position | :± |
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:CRE12196.1 | CRE12196.1 | [unknown] |
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| Cre-tpk-1, ATCACACGATGTCAACGTTGTCCACTTTGGTTCGATTCGTTCGAAATGAAACACCAATTA, WBGene00086404 | Expr1103459 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |
Powered by
