WormBase Gene ID
|
WBGene00080995 | Gene Name | Cre-nhr-112 |
| Sequence Name
|
CRE08644 | Organism | Caenorhabditis remanei |
| Automated Description | Predicted to enable DNA-binding transcription factor activity; sequence-specific DNA binding activity; and zinc ion binding activity. Predicted to be involved in regulation of DNA-templated transcription. Is an ortholog of C. elegans nhr-112. In C. elegans, nhr-112 is involved in defense response to Gram-negative bacterium and innate immune response. | Biotype | SO:0001217 |
| Genetic Position | :± |
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:CRE08644.1 | CRE08644.1 | [unknown] |
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| CRE08644, AGTTTATGGAAGAAATGATGATTTGTGAAATGCATAATGTCAGAATACACGATGATTTCA, WBGene00080995 | Expr1101862 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |
Powered by
