WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00075128 Gene Name  CRE13865
Sequence Name  ? CRE13865 Organism  Caenorhabditis remanei
Automated Description  Predicted to enable oxidoreductase activity, acting on paired donors, with oxidation of a pair of donors resulting in the reduction of molecular oxygen to two molecules of water. Is an ortholog of C. elegans fat-6 and fat-7. In C. elegans, fat-6 is involved in innate immune response; long-chain fatty acid biosynthetic process; and post-embryonic development. Biotype  SO:0001217
Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis remanei 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CRE13865.1 CRE13865.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CRE13865 CRE13865   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  

0 Downstream Intergenic Region

0 Expression Clusters

2 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cre-fat-6, CTCTTGGACTTGTCTATGATCGAAAAACTGTTGCTGATGAAATCATTGACCGACAAGTTA, WBGene00066344   Expr1098009 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CRE13865, TATCGCACTTCTGAATATTCCTTGAAATACAATTGGACGAGAGTTCTTATTGATGTTGCT, WBGene00075128   Expr1104664 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

1 GO Annotation

Annotation Extension Qualifier
  enables

0 Homologues

0 Locations

1 Ontology Annotations

Annotation Extension Qualifier
  enables

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region