WormBase Gene ID
|
WBGene00073085 | Gene Name | CRE31578 |
| Sequence Name
|
CRE31578 | Organism | Caenorhabditis remanei |
| Automated Description | Predicted to enable ATP binding activity and protein serine/threonine kinase activity. Predicted to be involved in protein phosphorylation. Is an ortholog of C. elegans ZK622.1; ZK593.9; and ZC581.7. In C. elegans, frk-1 is involved in several processes, including embryonic body morphogenesis; negative regulation of canonical Wnt signaling pathway; and regulation of epidermal cell differentiation. | Biotype | SO:0001217 |
| Genetic Position | :± |
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:CRE31578.1 | CRE31578.1 | [unknown] |
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| CRE31578, GACGGACAAGCGTGCGACGAGATGAAGAAAAAGTGCAAATACGAGCCGCCAGCTGACATG, WBGene00073085 | Expr1113804 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |
Powered by
