WormBase Gene ID
|
WBGene00071292 | Gene Name | Cre-dss-1 |
| Sequence Name
|
CRE26804 | Organism | Caenorhabditis remanei |
| Automated Description | Predicted to be involved in mRNA export from nucleus and proteasome assembly. Predicted to be part of proteasome regulatory particle, lid subcomplex. Is an ortholog of C. elegans dss-1. In C. elegans, dss-1 is involved in several processes, including intestinal absorption; positive regulation of protein ubiquitination; and vulval development. | Biotype | SO:0001217 |
| Genetic Position | :± |
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:CRE26804.1 | CRE26804.1 | [unknown] |
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| Cre-dss-1, AGTGAATTCTCGAAACAATTGAAGGAGGAACTTCGCAAAGGAGGACACCCAATCGCCTGA, WBGene00071292 | Expr1118081 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |
Powered by
