WormBase Gene ID
|
WBGene00071186 | Gene Name | Cre-pef-1 |
| Sequence Name
|
CRE25744 | Organism | Caenorhabditis remanei |
| Automated Description | Predicted to enable metal ion binding activity and phosphoprotein phosphatase activity. Predicted to be involved in detection of stimulus involved in sensory perception. Is an ortholog of C. elegans pef-1. | Biotype | SO:0001217 |
| Genetic Position | :± |
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:CRE25744.1 | CRE25744.1 | [unknown] |
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| Cre-pef-1, GATTATATTTCTCAAATCGCCGAGTCCATCGACTTCAACAAAGACGGATTCATTGACTTG, WBGene00071186 | Expr1096886 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |
Powered by
