WormBase Gene ID
|
WBGene00065025 | Gene Name | Cre-mab-23 |
| Sequence Name
|
CRE12856 | Organism | Caenorhabditis remanei |
| Automated Description | Predicted to enable sequence-specific DNA binding activity. Predicted to be involved in regulation of DNA-templated transcription. Predicted to be located in nucleus. Is an ortholog of C. elegans mab-23. In C. elegans, mab-23 is involved in several processes, including neuron fate determination; regulation of male mating behavior; and regulation of nematode male tail tip morphogenesis. | Biotype | SO:0001217 |
| Genetic Position | :± |
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:CRE12856.1 | CRE12856.1 | [unknown] |
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| Cre-mab-23, AAATGAGCAGTATCTTTCATTCAGCGGAGATGTTGGCCATCGGAGAATCCACTAATTCAC, WBGene00065025 | Expr1105658 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |
Powered by
