WormBase Gene ID
|
WBGene00064566 | Gene Name | Cre-cmk-1 |
| Sequence Name
|
CRE31389 | Organism | Caenorhabditis remanei |
| Automated Description | Predicted to enable ATP binding activity and protein kinase activity. Predicted to be involved in protein phosphorylation. Is an ortholog of C. elegans cmk-1. In C. elegans, cmk-1 is involved in several processes, including neuron projection morphogenesis; positive regulation of transcription by RNA polymerase II; and thermosensory behavior. | Biotype | SO:0001217 |
| Genetic Position | :± |
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:CRE31389.1 | CRE31389.1 | [unknown] |
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| Cre-cmk-1, CATTCACGGAACTGTCGCCGTGCACCTCAAGAAGAGTTTGGCAAAGAGGAACTGGAAGAA, WBGene00064566 | Expr1106000 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |
Powered by
