WormBase Gene ID
|
WBGene00060813 | Gene Name | Cre-dlk-1 |
| Sequence Name
|
CRE14190 | Organism | Caenorhabditis remanei |
| Automated Description | Predicted to enable ATP binding activity and MAP kinase kinase kinase activity. Predicted to be involved in protein autophosphorylation. Is an ortholog of C. elegans dlk-1. In C. elegans, dlk-1 is involved in several processes, including p38MAPK cascade; regulation of axon extension; and sprouting of injured axon. | Biotype | SO:0001217 |
| Genetic Position | :± |
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:CRE14190.1 | CRE14190.1 | [unknown] |
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| Cre-dlk-1, ACAAGCCATAATTCATCAACGTATCGAAGAATACTCTTCATCTGCCACCGACGATAGCGA, WBGene00060813 | Expr1105264 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |
Powered by
