WormBase Gene ID
|
WBGene00058833 | Gene Name | Cre-fos-1 |
| Sequence Name
|
CRE30840 | Organism | Caenorhabditis remanei |
| Automated Description | Predicted to enable DNA binding activity and DNA-binding transcription factor activity. Predicted to be involved in regulation of transcription by RNA polymerase II. Is an ortholog of C. elegans fos-1. In C. elegans, fos-1 is involved in several processes, including determination of adult lifespan; negative regulation of stress response to copper ion; and regulation of gene expression. | Biotype | SO:0001217 |
| Genetic Position | :± |
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:CRE30840.1 | CRE30840.1 | [unknown] |
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| Cre-fos-1, CAAAAATCGAAATGGATCGAACACTTGCTTCGTTGGCAGAAGACGTGGAACGCCCGTCGA, WBGene00058833 | Expr1105123 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |
Powered by
