WormBase Gene ID
|
WBGene00058000 | Gene Name | Cre-elt-7 |
| Sequence Name
|
CRE18587 | Organism | Caenorhabditis remanei |
| Automated Description | Predicted to enable DNA-binding transcription factor activity; sequence-specific DNA binding activity; and zinc ion binding activity. Predicted to be involved in regulation of transcription by RNA polymerase II. Is an ortholog of C. elegans elt-7. In C. elegans, elt-7 is involved in endodermal cell fate determination. | Biotype | SO:0001217 |
| Genetic Position | :± |
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:CRE18587.1 | CRE18587.1 | [unknown] |
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| Cre-elt-7, CTTCCGTCATAATAAAAAGAAACGTCCACTTTCTCTTCGGAAGGAGAAACCAGCCACGAG, WBGene00058000 | Expr1096122 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |
Powered by
