WormBase Gene ID
|
WBGene00057741 | Gene Name | Cre-efl-1 |
| Sequence Name
|
CRE19082 | Organism | Caenorhabditis remanei |
| Automated Description | Predicted to enable RNA polymerase II cis-regulatory region sequence-specific DNA binding activity and protein dimerization activity. Predicted to be involved in regulation of transcription by RNA polymerase II. Predicted to be part of transcription regulator complex. Is an ortholog of C. elegans efl-1. In C. elegans, efl-1 is involved in several processes, including negative regulation of Ras protein signal transduction; negative regulation of vulval development; and regulation of gene expression. | Biotype | SO:0001217 |
| Genetic Position | :± |
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:CRE19082.1 | CRE19082.1 | [unknown] |
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| Cre-efl-1, GGTCCATTACGTGCTGCGATTGTTTCAAATCACGAATTACACGATTTTGTGCAACGAGAA, WBGene00057741 | Expr1098142 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |
Powered by
