WormBase Gene ID
|
WBGene00055388 | Gene Name | Cre-efk-1 |
| Sequence Name
|
CRE02916 | Organism | Caenorhabditis remanei |
| Automated Description | Predicted to enable calmodulin binding activity; elongation factor-2 kinase activity; and small molecule binding activity. Predicted to be involved in protein phosphorylation. Is an ortholog of C. elegans efk-1. | Biotype | SO:0001217 |
| Genetic Position | :± |
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:CRE02916.1 | CRE02916.1 | [unknown] |
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| Cre-efk-1, GTATAAAGAAGGCGGATACGGACTGAATCAAGACTTCGAACGAGCCTACTGTCTGTTCAA, WBGene00055388 | Expr1110723 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |
Powered by
